BPG is committed to discovery and dissemination of knowledge
Brief Article Open Access
©2010 Baishideng. All rights reserved.
World J Gastroenterol. Jan 28, 2010; 16(4): 474-478
Published online Jan 28, 2010. doi: 10.3748/wjg.v16.i4.474
Clinical relevance of Helicobacter pylori babA2 and babA2/B in Costa Rica and Japan
Sergio A Con, Reinaldo Con-Wong, Centro Digestivo Doctores Con-Mediplaza, 245-1200 San José, Costa Rica
Sergio A Con, Hiroaki Takeuchi, Mitsuaki Nishioka, Norihito Morimoto, Tetsuro Sugiura, Department of Clinical Laboratory Medicine, Kochi Medical School, Kochi University, Nankoku-city, Kochi 783-8505, Japan
Nobufumi Yasuda, Department of Public Health, Kochi Medical School, Kochi University, Nankoku-city, Kochi 783-8505, Japan
Author contributions: Con SA designed, performed the research and wrote the paper; Nishioka M, Con-Wong R, Morimoto N, and Sugiura T contributed reagents/analytic tools; Yasuda N analyzed the data; Takeuchi H revised the paper.
Supported by (in part) A Grant-in-Aid for Scientific Research from the Ministry of Education, Science and Culture of Japan (21590631) and by the Project Research Fund from the Kochi University
Correspondence to: Sergio A Con, MD, PhD, Centro Digestivo Doctores Con-Mediplaza, 245-1200 San José, Costa Rica. scon@gastrocolon.com
Telephone: +506-2201-7028 Fax: +506-2201-7033
Received: July 29, 2009
Revised: October 13, 2009
Accepted: October 20, 2009
Published online: January 28, 2010

Abstract

AIM: To evaluate the prevalence of Helicobacter pylori (H. pylori) babA2, babB and a recombinant gene between babA2 and babB (babA2/B), and their role in the development of atrophic gastritis in Costa Rican and Japanese clinical isolates.

METHODS: A total of 95 continuous H. pylori-positive Costa Rican (41 males and 54 females; mean age, 50.65 years; SD, ± 13.04 years) and 95 continuous H. pylori-positive Japanese (50 males and 45 females; mean age, 63.43; SD, ± 13.21 years) patients underwent upper endoscopy from October 2005 to July 2006. They were enrolled for the polymerase chain reaction (PCR)-based genotyping of the H. pylori babA2, babB and babA2/B genes. Statistical analysis was performed using the χ2 test and the Fisher’s exact probability test and multivariate analysis was performed by logistic regression adjusting for gender and age. P < 0.05 was regarded as statistically significant.

RESULTS: The PCR-based genotyping of 95 Costa Rican and 95 Japanese isolates showed a higher prevalence of babA2 in Japan (96.8%) than in Costa Rica (73.7%), while that of babA2/B was higher in Costa Rica (11.6%) than in Japan (1.1%). In Costa Rican isolates only, babA2 was significantly associated with atrophic gastritis (P = 0.01).

CONCLUSION: These results suggest that the status of babA2 and babA2/B shows geographic differences, and that babA2 has clinical relevance in Costa Rica.

Key Words: babA2; babA2/B; Costa Rica; Helicobacter pylori; Japan



INTRODUCTION

Helicobacter pylori (H. pylori) infects the human stomach causing chronic inflammation, which can lead to peptic ulcer and gastric cancer[1,2]. The diverse clinical outcome of gastric disease may involve differences in the prevalence or expression of bacterial virulence factors. H. pylori BabA is a blood-group antigen-binding adhesin encoded by the babA2 gene, which has been shown to mediate adherence of H. pylori to human Lewis b blood-group (Leb) antigens[3,4]. Although three bab alleles have been identified (babA1, babA2 and babB), only the babA2 gene product is functional for Leb binding activity[5,6]. Studies in Western countries have disclosed associations between the presence of babA2 gene and digestive diseases such as duodenal ulcer and gastric cancer[4]. However, in Asia, most of the H. pylori strains are babA2-positive, irrespective of clinical outcome[7,8]. Thus, conclusions about the relationship between H. pylori genotypes and clinical outcome derived from one geographic region may not be true for other geographic regions. Evidence concerning BabA adhesin-associated genes is insufficient in Costa Rica, where the incidence of gastric cancer is very high, similar to Japan[9]. The babA2 gene, which encodes BabA, may play a role in the development of gastric cancer in the Costa Rican population. In order to investigate this hypothesis we aimed to correlate the status of babA2 in Costa Rican clinical isolates with atrophic gastritis, a gastric premalignant lesion. In addition, because H. pylori populations are highly diverse and are constantly changing their genome by point mutations, substitutions, insertions, and/or deletions of their genome[10-12], we decided to evaluate the prevalence of a recombinant gene between babA2 and babB (babA2/B), already identified in vitro[13,14], in Costa Rican as well as in Japanese clinical isolates, which were used also in this study for comparative purposes.

MATERIALS AND METHODS
Study population

Half of the patients in this study attended a digestive center in San Jose, Costa Rica and the other half attended a National University in Kochi, Japan. A total of 95 continuous H. pylori-positive Costa Rican (41 males and 54 females; mean age, 50.65 years; SD, ± 13.04 years) and 95 continuous H. pylori-positive Japanese (50 males and 45 females; mean age, 63.43; SD, ± 13.21 years) patients underwent upper endoscopy from October 2005 to July 2006. They were enrolled for the polymerase chain reaction (PCR)-based genotyping of H. pylori babA2, babB and babA2/B genes. Informed consent was obtained from each patient and the study was approved by the Ethics Committee of the institutions. Information was collected on age, gender, symptoms and medication. None of the participating patients had undergone H. pylori eradication therapy or gastric surgery. In addition, none of the patients had recent intake of proton pump inhibitors, antibiotics, or non-steroidal anti-inflammatory drugs. The patients were histopathologically classified into two groups; atrophic gastritis (AG) group (29 Costa Rican and 48 Japanese) and non-atrophic gastritis (NAG) group (66 Costa Rican and 47 Japanese) according to the updated Sydney System for the classification of gastritis[15].

Endoscopical and histological evaluations

Endoscopy was performed with Olympus EVIS EXERA I/II systems (Olympus America Inc., San Jose, CA, USA). From each participating subject, at least four biopsies (from the antrum, corpus and cisura angularis) were collected for histological examination. In addition, one antral biopsy was also taken to obtain the clinical isolates following bacterial culture.

The biopsy samples were conventionally fixed in 100 mL/L formaldehyde anidre and embedded in paraffin. Serial 3- to 4-μm sections were stained with hematoxylin and eosin for histological observation. All biopsies were examined for the presence of glandular atrophy and were scored into four grades (0: none, 1: mild, 2: moderate and 3: marked) for both the antrum and the body of the stomach, according to the updated Sydney System of classification and grading of gastritis[15]. Gastric glandular atrophy was defined as the loss of gastric glands and its replacement with fibrosis or metaplastic epithelium.

Determination of H. pylori infection

H. pylori infection was determined by either the rapid urease test (RUT) or histological examination in biopsy specimens obtained from the antrum, cisura angularis and body of the stomach. Patients were considered H. pylori-positive if either the biopsy specimen was positive for RUT or the bacterium was observed in any of the hematoxylin and eosin-stained sections.

Isolation of H. pylori from biopsy specimens and DNA extraction

The homogenized biopsy specimens were placed on H. pylori selective agar plates (Helico VI agar, E-MS70, Eiken Chemical Co., Ltd., Japan) and cultured at 37°C under microaerobic conditions (100 mL/L CO2) for five to seven days. The presence of H. pylori colonies was confirmed by typical morphology, Gram staining and a positive urease test. Eventually, a total of 190 clinical isolates obtained from antrum specimens were subjected to genomic DNA (gDNA) extraction using a DNA kit (Qiagen, Tokyo, Japan) according to the manufacturer’s instructions.

Detection of H. pylori babA2, babB and babA2/B genes by PCR

The genomic DNAs were subjected to PCR-based genotyping of babA2, babB and babA2/B using two primer pairs including primers previously described[4,16] and new primers (Table 1) designed based on sequences of referential H. pylori strains 26 695 and J99. We used PCR conditions exactly matching those described[4,16] and the conditions for the new primers used in this study are shown in Table 1. Whenever necessary, in particular, to determine babA2/B, sequence analysis of the putative products was performed using Applied Biosystems 3130 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) and these sequences were compared with babA and babB genes of strains 26 695 (HP1243 and HP896, respectively) and J99 (jhp833 and jhp1164, respectively) using the BLAST 2 SEQUENCES system (http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi)[17]. When the putative recombinant gene was shown to be only homologous at the 5’ and 3’ positions of babA2 gene open reading frame (ORF) and babB gene ORF, respectively, the gene was considered to be a recombinant babA2/B gene.

Table 1 PCR primers and conditions for detection of babA2, babB and babA2/B genes.
RegionPrimerNucleotide sequence (5’- 3’)PCR conditionsRef.
babA2babA-FAATCCAAAAAGGAGAAAAAGTATGAAA[4]
babA-RTGTTAG TGATTTCGGTGTAGGACA
babA2-Fnc1GAAAAAACATGAAAAAACACATCCTTTCAT[16]
babA2-Rmn2TCTGGGTTAATGGCTTGCC
babBbabB-Fnc1CTCTCTCTCGTTTTTGCTCCA96°C for 2 min, 30 cycles (96°C for 30 s, 48°C for 30 s, 72°C for 1 min)This study
babB-Rnc1CTTCATAACACACCCCTAAAGAGTC
babB-Fnc3ATGAAAAAAACCCTTTTACTC96°C for 2 min, 30 cycles (96°C for 30 s, 46°C for 30 s, 72°C for 1 min)This study
babB-Rnc3TGACCTGGATTGGTGCCCCTACG
babA2/BbabA-FAATCCAAAAAGGAGAAAAAGTATGAAA[4]
babB-Rnc1CTTCATAACACACCCCTAAAGAGTC
babA2-Fnc1GAAAAAACATGAAAAAACACATCCTTTCAT[16]
babB-Rnc1CTTCATAACACACCCCTAAAGAGTC96°C for 2 min, 30 cycles (96°C for 30 s, 62°C for 30 s, 72°C for 1 min)This study
babB-Rnc21CTACGCTCACCCCCTTGTACTTC96°C for 2 min, 30 cycles (96°C for 30 s, 63°C for 30 s, 72°C for 1 min)This study
babB-Rnc31TGACCTGGATTGGTGCCCCTACG96°C for 2 min, 30 cycles (96°C for 30 s, 62°C for 30 s, 72°C for 1 min)This study
Statistical analysis

Statistical analysis was performed using the χ2 test and the Fisher’s exact probability test [STATA SE (version 8) statistical software]. P < 0.05 was regarded as statistically significant. Multivariate analysis was performed by logistic regression [SPSS 13.0 Japanese version (SPSS Japan Inc., 2005)] adjusting for gender and age. Odds ratios with 95% confidence intervals were used to study the influence of these genes on the development of gastric atrophy.

RESULTS
Comparison of gender and age of patients between AG and NAG

There was no significant difference in gender between the AG group and NAG group from either Costa Rica or Japan (Table 2). However, mean age was significantly higher in the AG group than in the NAG group of both Costa Rican and Japanese patients.

Table 2 Characteristics of Costa Rican and Japanese dyspeptic patients.
Costa Rican
Japanese
AGNAGP-valueAGNAGP-value
Patients number29664847
Sex (M/F)15/1426/400.26424/2426/210.604
mean age ± SD (yr)54.8 ± 12.948.9 ± 12.80.04168.4 ± 10.258.4 ± 14.1< 0.001
Prevalence of gastric atrophy in Costa Rican and Japanese patients

In Costa Rican patients, the prevalence of gastric atrophy was 30.5% (29/95) while that in Japanese patients was considerably higher (50.5%, 48/95).

H. pylori babA2, babB and babA2/B genes in clinical isolates

In Costa Rican patients, the prevalence of babA2 was 73.7% (70/95) and after gender and age adjustment, this gene was found to be significantly associated with AG in this population (P = 0.01) (Table 3). The prevalence of babB and babA2/B was 81.1% (77/95) and 11.6% (11/95), respectively, and no significant differences were found between any of these genes and AG.

Table 3 H. pylori babA2, babB and babA2/B genes according to atrophic gastritis in Costa Rican and Japanese patients.
Costa Rican patients
Japanese patients
GeneAG/NAGPOR95% CIAG/NAGPOR95% CI
babA2
Pos27/430.017.801.63-37.4046/460.880.820.06-10.70
Neg2/231.00(Ref.)2/11.00(Ref.)
babB
Pos25/520.541.470.42-5.1245/410.183.000.61-14.70
Neg4/141.00(Ref.)3/61.00(Ref.)
babA2/B
Pos6/50.103.070.80-11.800/11.000.00
Neg23/611.00(Ref.)48/461.00(Ref.)

In Japanese patients, almost all patients were found to be babA2-positive (96.8%, 92/95), while only one patient had the babA2/B gene (98.9%). The prevalence of babB was 90.5% (86/95). After gender and age adjustment, no significant differences were found between any of these genes and AG in this population.

DISCUSSION

The prevalence of babA2 in Costa Rican isolates was 73.7%, which was higher than that shown in Western studies (38%-43%)[18-20], but lower than that in Asian studies (80%-100%)[7,21-23], including that in our Japanese isolates (96.8%) (Table 3). It seems that the prevalence of babA2 does not parallel the incidence rate of gastric cancer in those countries, since Costa Rica, has an incidence rate comparable to that of Japan and China[9].

The babA2 and babB genes exhibit extensive homologies at their 5’ and 3’ ends that should facilitate frequent recombination between them, suggesting that a recombination might interfere in the expression and functional activity of BabA. In this study, this recombination was found in 11 and 1 Costa Rican and Japanese (KMT28) isolates, respectively, irrespective of clinical outcome. However, in the Costa Rican strains, the babA2 gene was found to be significantly associated with AG (P = 0.01 and OR = 7.8) (Table 3). This association has been reported previously in Western studies[9].

The PCR products of 12 babA2/B recombinant strains were employed for sequence analysis, revealing that several stop-codons in the amino acid sequence were found in all 11 Costa Rican strains, suggesting that these genes were non-functional. In contrast, since the Japanese strain KMT28 had complete in-frame sequence, the babA2/B gene was thought to be functional. In addition, reverse transcription-PCR (Toyobo Co., Ltd., Japan) using mRNA extracted from the KMT28 strain possessing the babA2/B gene with Trizol reagent (Invitrogen Corp., Carlsbad, CA, USA), and sequence analysis were performed, demonstrating that the babA2/B transcript of KMT28 was definitely obtained and the sequence was identical to the babA2/B sequence (data not shown).

The relationship between babA2-positive H. pylori and an increased risk of developing clinical outcomes is controversial[7,18,20,24-26], because the presence of babA2 is not always to reflect the BabA binding activity due to regulation by the number of transcriptional start adenine [poly (A)] residues in the promoter region[5] and the presence of chimeric babA/B or babB/A genes[14,27]. Moreover, it is relatively difficult to detect the babA2 gene by PCR with a single primer pair due to high homology between the sequences of babA1 and babA2. Thus, to determine BabA binding activity and/or the presence of its transcript it was critical to consider the functionality of BabA and its pathogenesis. Therefore we used at least two primer pairs to confirm the presence of babA2 and recombinant babA2/B genes and investigated the relationship between the status of these genes and clinical outcomes.

Taken together, the status of babA2 and babA2/B shows geographic differences, and babA2 seems to have clinical relevance only in Costa Rica. A functional babA2/B was found in one Japanese isolate. However, we believe that a binding assay with Leb antigen is necessary to confirm whether the BabA is functional and/or the adhesive strength is regulated individually depending on an adaptation of the microorganism in the stomach involved in clinical manifestation.

COMMENTS
Background

The clinical outcome of gastric disease may involve differences in the prevalence or expression of bacterial virulence factors. Contrary to Asian studies, western studies have disclosed associations between the presence of babA2 gene and gastric cancer. Evidence concerning BabA adhesin-associated genes is insufficient in Costa Rica, where the incidence of gastric cancer is very high, similar to Japan. The babA2 gene, which encodes BabA, may play a role in the development of gastric cancer in the Costa Rican population.

Research frontiers

The research in this area is focused on the correlation between the status of babA2 in Costa Rican clinical isolates and atrophic gastritis, a gastric premalignant lesion, and on the evaluation of the prevalence of a recombinant gene between babA2 and babB (babA2/B), in Costa Rican and Japanese clinical isolates.

Innovations and breakthroughs

The PCR-based genotyping of 95 Costa Rican and 95 Japanese isolates showed a higher prevalence of babA2 in Japan (96.8%) than in Costa Rica (73.7%), while that of babA2/B was higher in Costa Rica (11.6%) than in Japan (1.1%). In Costa Rican isolates only, babA2 was significantly associated with atrophic gastritis (P = 0.01).

Applications

These results suggest that the status of babA2 and babA2/B shows geographic differences, and that babA2 has clinical relevance in Costa Rica.

Terminology

Helicobacter pylori (H. pylori) is a Gram-negative microaerobic bacterium that persistently colonizes the human gastric mucosa. H. pylori BabA is a blood-group antigen-binding adhesin encoded by the babA2 gene, which has been shown to mediate adherence of H. pylori to human Lewis b blood-group antigens.

Peer review

This paper has a correct design and is presented adequately. Title, results and discussion are clear and properly expressed. This topic is controversial, in some way, and this investigation constitutes an interesting contribution.

References
1.  Kuipers EJ, Uyterlinde AM, Peña AS, Roosendaal R, Pals G, Nelis GF, Festen HP, Meuwissen SG. Long-term sequelae of Helicobacter pylori gastritis. Lancet. 1995;345:1525-1528.  [PubMed]  [DOI]
2.  Uemura N, Okamoto S, Yamamoto S, Matsumura N, Yamaguchi S, Yamakido M, Taniyama K, Sasaki N, Schlemper RJ. Helicobacter pylori infection and the development of gastric cancer. N Engl J Med. 2001;345:784-789.  [PubMed]  [DOI]
3.  Borén T, Falk P, Roth KA, Larson G, Normark S. Attachment of Helicobacter pylori to human gastric epithelium mediated by blood group antigens. Science. 1993;262:1892-1895.  [PubMed]  [DOI]
4.  Gerhard M, Lehn N, Neumayer N, Borén T, Rad R, Schepp W, Miehlke S, Classen M, Prinz C. Clinical relevance of the Helicobacter pylori gene for blood-group antigen-binding adhesin. Proc Natl Acad Sci USA. 1999;96:12778-12783.  [PubMed]  [DOI]
5.  Ilver D, Arnqvist A, Ogren J, Frick IM, Kersulyte D, Incecik ET, Berg DE, Covacci A, Engstrand L, Borén T. Helicobacter pylori adhesin binding fucosylated histo-blood group antigens revealed by retagging. Science. 1998;279:373-377.  [PubMed]  [DOI]
6.  Pride DT, Meinersmann RJ, Blaser MJ. Allelic Variation within Helicobacter pylori babA and babB. Infect Immun. 2001;69:1160-1171.  [PubMed]  [DOI]
7.  Mizushima T, Sugiyama T, Komatsu Y, Ishizuka J, Kato M, Asaka M. Clinical relevance of the babA2 genotype of Helicobacter pylori in Japanese clinical isolates. J Clin Microbiol. 2001;39:2463-2465.  [PubMed]  [DOI]
8.  Sheu BS, Sheu SM, Yang HB, Huang AH, Wu JJ. Host gastric Lewis expression determines the bacterial density of Helicobacter pylori in babA2 genopositive infection. Gut. 2003;52:927-932.  [PubMed]  [DOI]
9.  Kuroishi T, Hirose K, Takezaki T, Tominaga S, Aoki K, Tajima K. Cancer mortality statistics in 30 countries (1953-1997). Cancer mortality and morbidity statistics. Tokyo: Japan Scientific Societies Press 2004; 165-229.  [PubMed]  [DOI]
10.  Suerbaum S, Michetti P. Helicobacter pylori infection. N Engl J Med. 2002;347:1175-1186.  [PubMed]  [DOI]
11.  Peek RM Jr, Blaser MJ. Helicobacter pylori and gastrointestinal tract adenocarcinomas. Nat Rev Cancer. 2002;2:28-37.  [PubMed]  [DOI]
12.  Blaser MJ, Berg DE. Helicobacter pylori genetic diversity and risk of human disease. J Clin Invest. 2001;107:767-773.  [PubMed]  [DOI]
13.  Aspholm-Hurtig M, Dailide G, Lahmann M, Kalia A, Ilver D, Roche N, Vikström S, Sjöström R, Lindén S, Bäckström A. Functional adaptation of BabA, the H. pylori ABO blood group antigen binding adhesin. Science. 2004;305:519-522.  [PubMed]  [DOI]
14.  Bäckström A, Lundberg C, Kersulyte D, Berg DE, Borén T, Arnqvist A. Metastability of Helicobacter pylori bab adhesin genes and dynamics in Lewis b antigen binding. Proc Natl Acad Sci USA. 2004;101:16923-16928.  [PubMed]  [DOI]
15.  Dixon MF, Genta RM, Yardley JH, Correa P. Classification and grading of gastritis. The updated Sydney System. International Workshop on the Histopathology of Gastritis, Houston 1994. Am J Surg Pathol. 1996;20:1161-1181.  [PubMed]  [DOI]
16.  Con SA, Takeuchi H, Con-Chin GR, Con-Chin VG, Yasuda N, Con-Wong R. Role of bacterial and genetic factors in gastric cancer in Costa Rica. World J Gastroenterol. 2009;15:211-218.  [PubMed]  [DOI]
17.  Tatusova TA, Madden TL. BLAST 2 Sequences, a new tool for comparing protein and nucleotide sequences. FEMS Microbiol Lett. 1999;174:247-250.  [PubMed]  [DOI]
18.  Oliveira AG, Santos A, Guerra JB, Rocha GA, Rocha AM, Oliveira CA, Cabral MM, Nogueira AM, Queiroz DM. babA2- and cagA-positive Helicobacter pylori strains are associated with duodenal ulcer and gastric carcinoma in Brazil. J Clin Microbiol. 2003;41:3964-3966.  [PubMed]  [DOI]
19.  Zambon CF, Navaglia F, Basso D, Rugge M, Plebani M. Helicobacter pylori babA2, cagA, and s1 vacA genes work synergistically in causing intestinal metaplasia. J Clin Pathol. 2003;56:287-291.  [PubMed]  [DOI]
20.  Oleastro M, Gerhard M, Lopes AI, Ramalho P, Cabral J, Sousa Guerreiro A, Monteiro L. Helicobacter pylori virulence genotypes in Portuguese children and adults with gastroduodenal pathology. Eur J Clin Microbiol Infect Dis. 2003;22:85-91.  [PubMed]  [DOI]
21.  Yu J, Leung WK, Go MY, Chan MC, To KF, Ng EK, Chan FK, Ling TK, Chung SC, Sung JJ. Relationship between Helicobacter pylori babA2 status with gastric epithelial cell turnover and premalignant gastric lesions. Gut. 2002;51:480-484.  [PubMed]  [DOI]
22.  Lai CH, Kuo CH, Chen YC, Chao FY, Poon SK, Chang CS, Wang WC. High prevalence of cagA- and babA2-positive Helicobacter pylori clinical isolates in Taiwan. J Clin Microbiol. 2002;40:3860-3862.  [PubMed]  [DOI]
23.  Kim SY, Woo CW, Lee YM, Son BR, Kim JW, Chae HB, Youn SJ, Park SM. Genotyping CagA, VacA subtype, IceA1, and BabA of Helicobacter pylori isolates from Korean patients, and their association with gastroduodenal diseases. J Korean Med Sci. 2001;16:579-584.  [PubMed]  [DOI]
24.  Gatti LL, Fagundes e Souza EK, Leite KR, Bastos EL, Vicentini LR, Silva LC, Smith Mde A, Payão SL. cagA vacA alelles and babA2 genotypes of Helicobacter pylori associated with gastric disease in Brazilian adult patients. Diagn Microbiol Infect Dis. 2005;51:231-235.  [PubMed]  [DOI]
25.  Olfat FO, Zheng Q, Oleastro M, Voland P, Borén T, Karttunen R, Engstrand L, Rad R, Prinz C, Gerhard M. Correlation of the Helicobacter pylori adherence factor BabA with duodenal ulcer disease in four European countries. FEMS Immunol Med Microbiol. 2005;44:151-156.  [PubMed]  [DOI]
26.  Han YH, Liu WZ, Zhu HY, Xiao SD. Clinical relevance of iceA and babA2 genotypes of Helicobacter pylori in a Shanghai population. Chin J Dig Dis. 2004;5:181-185.  [PubMed]  [DOI]
27.  Solnick JV, Hansen LM, Salama NR, Boonjakuakul JK, Syvanen M. Modification of Helicobacter pylori outer membrane protein expression during experimental infection of rhesus macaques. Proc Natl Acad Sci USA. 2004;101:2106-2111.  [PubMed]  [DOI]
Footnotes

Peer reviewer: Julio H Carri, Professor, Internal Medicine - Gastroenterology, National University of Córdoba, Av. Estrada 160-P 5-Department D, Córdoba 5000, Argentina

S- Editor Wang JL L- Editor Webster JR E- Editor Ma WH

Write to the Help Desk