BPG is committed to discovery and dissemination of knowledge
Original Article Open Access
©2010 Baishideng. All rights reserved
World J Gastroenterol. Jan 21, 2010; 16(3): 330-338
Published online Jan 21, 2010. doi: 10.3748/wjg.v16.i3.330
Aberrant gene methylation in the peritoneal fluid is a risk factor predicting peritoneal recurrence in gastric cancer
Masatsugu Hiraki, Yoshihiko Kitajima, Seiji Sato, Jun Nakamura, Kazuyoshi Hashiguchi, Hirokazu Noshiro, Kohji Miyazaki, Department of Surgery, Saga University Faculty of Medicine, 5-1-1 Nabeshima, Saga 849-8501, Japan
Author contributions: Hiraki M, Kitajima Y and Miyazaki K designed this study; Hiraki M performed all of the experiments and analyzed the data; Hiraki M interpreted the analyzed data and wrote the manuscript under the supervision of Kitajima Y; Nakamura J, Hashiguchi K, Sato S and Noshiro H contributed to the sample collection and advice concerning the study; Miyazaki K approved the final version of the manuscript.
Supported by Fund from the Department of Surgery, Saga University Faculty of Medicine
Correspondence to: Dr. Kohji Miyazaki, MD, PhD, Professor, Department of Surgery, Saga University Faculty of Medicine, 5-1-1 Nabeshima, Saga 849-8501, Japan. miyazak2@cc.saga-u.ac.jp
Telephone: +81-952-342349 Fax: +81-952-342019
Received: October 13, 2009
Revised: November 23, 2009
Accepted: November 30, 2009
Published online: January 21, 2010

Abstract

AIM: To investigate whether gene methylation in the peritoneal fluid (PF) predicts peritoneal recurrence in gastric cancer patients.

METHODS: The gene methylation of CHFR (checkpoint with forkhead and ring finger domains), p16, RUNX3 (runt-related transcription factor 3), E-cadherin, hMLH1 (mutL homolog 1), ABCG2 (ATP-binding cassette, sub-family G, member 2) and BNIP3 (BCL2/adenovirus E1B 19 kDa interacting protein 3) were analyzed in 80 specimens of PF by quantitative methylation-specific polymerase chain reaction (PCR). Eighty patients were divided into 3 groups; Group A (n = 35): the depth of cancer invasion was less than the muscularis propria; Group B (n = 31): the depth of cancer invasion was beyond the muscularis propria. Both group A and B were diagnosed as no cancer cells in peritoneal cytology and histology; Group C (n = 14): disseminated nodule was histologically diagnosed or cancer cells were cytologically defined in the peritoneal cavity.

RESULTS: The positive rates of methylation in CHFR, E-cadherin and BNIP3 were significantly different among the 3 groups and increased in order of group A, B and C (0%, 0% and 21% in CHFR, P < 0.05; 20%, 45% and 50% in E-cadherin, P < 0.05; 26%, 35% and 71% in BNIP3, P < 0.05). In addition, the multigene methylation rate among CHFR, E-cadherin and BNIP3 was correlated with group A, B and C (9%, 19% and 57%, P < 0.001). Moreover, the prognosis was analyzed in group B, excluding 3 patients who underwent a non-curative resection. Two of the 5 patients with multigene methylation showed peritoneal recurrence after surgery, while those without or with a single gene methylation did not experience recurrence (P < 0.05).

CONCLUSION: This study suggested that gene methylation in the PF could detect occult neoplastic cells in the peritoneum and might be a risk factor for peritoneal metastasis.

Key Words: Ascites; Dissemination; Gastric cancer; Methylation; Peritoneal fluid; Quantitative methylation-specific polymerase chain reaction



INTRODUCTION

Peritoneal metastasis is the most frequent event in recurrent gastric cancers, and occurs in 34% of patients with recurrences, even after curative resection of the primary tumor[1,2]. In addition, peritoneal metastasis shows resistance to various chemotherapeutic drugs and causes massive ascites and intestinal obstruction. In Japan, cytological examination of peritoneal washes using Papanicolaou staining is commonly performed during surgery to detect peritoneal metastasis. However, peritoneal metastasis sometimes occurs even in cases that show a negative cytological examination. The efficacy of immunocytology[3,4], tumor markers[5,6] and reverse transcriptase polymerase chain reaction (PCR) analysis of carcinoembryonic antigen (CEA), and cytokeratin (CK) mRNA[2,7-12] in the peritoneal washes has been examined.

Epigenetic gene silencing through DNA methylation occurs in various cancers. DNA methylation occurs in the CpG rich promoters of tumor suppressor genes, DNA repair and cell cycle checkpoint genes, resulting in suppressed gene expression[13,14]. Numerous studies have investigated gene methylation to assess the correlation with carcinogenesis and tumor progression in various cancers[15-17]. Recently, several reports have demonstrated aberrant gene methylation detected in salivary rinses[18], pleural effusion[19], peritoneal fluid (PF)[20,21], lymph node[22,23], breast ductal fluid[24], bile[25], pancreatic juice[26], urine[27], stool[28], serum and plasma[20,29,30] from patients with various tumors and suggested the feasibility of methylation analysis in the evaluation of occult neoplastic cells or micrometastasis.

The present study investigated whether DNA methylation using PF is a possible marker for determining gastric cancer micrometastasis to the peritoneum. The DNA methylation levels of 7 genes; CHFR (checkpoint with forkhead and ring finger domains), p16 (cyclin-dependent kinase inhibitor 2A), RUNX3 (runt-related transcription factor 3), E-cadherin, hMLH1 (mutL homolog 1), ABCG2 (ATP-binding cassette, sub-family G, member 2), BNIP3 (BCL2/adenovirus E1B 19 kDa interacting protein 3) in 80 PF specimens were analyzed by quantitative methylation-specific polymerase chain reaction (q-MSP). Furthermore, quantitative reverse transcriptase-PCR (qRT-PCR) of CEA and CK19 mRNA was examined using the same samples and the results were compared with that of q-MSP. The goal of this study was to clarify whether gene methylation in PF is feasible for determining micrometastasis to the peritoneum in gastric cancer.

MATERIALS AND METHODS
Ethics

The study protocol was approved by the Ethics Committee of Saga University Faculty of Medicine. Informed consent was obtained from all the patients before collection of the samples.

Patients and sample collection

Peritoneal lavage fluid was obtained from 80 patients who underwent surgery at the Department of Surgery, Saga University Hospital from May 2007 to August 2008. A total volume of 200 mL of normal saline was poured into Douglas’s pouch and the left subphrenic space. One hundred milliliter of PF was examined by conventional cytological diagnosis with Papanicolaou staining. The remaining PF was centrifuged at 1200 g for 10 min and the pelleted cells were stored at -80°C until the extraction of genomic DNA and RNA. A gastrectomy was subsequently performed in 72 patients. A bypass operation or exploratory laparotomy was carried out in the remaining 8 patients due to either peritoneal dissemination or cytologically positive cancer cells. The histological type, depth of tumor invasion and clinical stage were determined on the basis of the criteria of the Japanese Classification of Gastric Carcinoma guidelines[31]. The 80 patients were further divided into 3 groups: Group A (n = 35): the depth of cancer invasion was less than the muscularis propria [tumor invasion of mucosa and/or muscularis mucosa (M) or submucosa (SM), tumor involved the muscularis propria (MP)]; Group B (n = 31): the depth of cancer invasion was beyond the muscularis propria [tumor involved the subserosa (SS), tumor penetrated the serosa (SE), tumor invasion of adjacent structures (SI)]; Group C (n = 14): a peritoneal metastasis was histologically diagnosed [P (+)] or cancer cells were present on peritoneal cytology [CY (+)]. No peritoneal metastasis [P (-)] and benign/ indeterminate cells on peritoneal cytology [CY (-)] were confirmed at surgery in the 66 patients in group A and group B. CY (+) or P (+) was simultaneously diagnosed at surgery in 12 of 14 patients in group C. In the remaining 2 patients, cancerous ascites were collected at the recurrence. The methylation analysis was performed using specimens obtained from all 80 patients. The mRNA analysis was done using 63 samples, because high quality RNA could not be extracted in specimens from the remaining 17 cases.

DNA extraction, sodium bisulfite modification and q-MSP

The genomic DNA was isolated from cell pellets from the abdominal fluid using an EZ1 DNA tissue kit (Qiagen, Hilden, Germany). Bisulfite modification was carried out using the EpiTet® Bisulfite Kit (Qiagen, Hilden, Germany) with 1500 ng of genomic DNA. Bisulfite-treated DNA was amplified by EpiTect® Whole Bisulfitome Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The 80 DNA samples with bisulfite modification were quantitatively analyzed for the methylation levels of 8 genes (CHFR, p16, RUNX3, E-cadherin, hMLH1, ABCG2, BNIP3 and β-actin; an internal marker). For q-MSP, a 2 μL aliquot was amplified by PCR using a primer set along with the Taqman probe specific for methylated sequences. A q-MSP (MethyLight) was carried out with the Light-Cycler™ instrument system (Roche, Mannheim, Germany) using the LightCycler® TaqMan® Master (Roche, Mannheim, Germany) according to a previous report[32]. The primer sequences are shown in Table 1[33-37]. After a denaturing step at 95°C for 10 min, PCR amplification was performed with 45 cycles of 15 s denaturing at 95°C, 5 s annealing at 60°C and a 10 s extension at 72°C. These experiments were carried out in triplicate and the mean value was then calculated. CpGenome Universally Methylated DNA (Chemicon, Temecula, CA, USA) was used as a positive control for methylation, and CpGenome Universal Unmethylated DNA (Chemicon) was used as a negative control. The quantified value of DNA methylation of a target gene was normalized by β-actin.

Table 1 Primer and probe sequence of the LightCycler system for q-MSP.
GenePrimer sequenceRef.
CHFRForwardTTTCGTGATTCGTAGGCGAC[33]
ReverseCGACAACTAAAACGAAACCGA
Probe5' FAM-CGCGAAAATAAACGCGTAAAAAACGCTCG-3'BHQ
p16ForwardTGGAATTTTCGGTTGATTGGTT[34]
ReverseAACAACGTCCGCACCTCCT
Probe5' FAM- ACCCGACCCCGAACCGCG -3'BHQ
RUNX3ForwardCGTTCGATGGTGGACGTGT[35]
ReverseGACGAACAACGTCTTATTACAACGC
Probe5' FAM-CGCACGAACTCGCCTACGTAATCCG-3'BHQ
E-cadherinForwardAATTTTAGGTTAGAGGGTTATCGCGT[34,36]
ReverseTAACTAAAAATTCACCTACCGAC
Probe5' FAM-CGCCCACCCGACCTCGCAT-3'BHQ
hMLH1ForwardCGTTATATATCGTTCGTAGTATTCGTGTTT[34]
ReverseCTATCGCCGCCTCATCGT
Probe5' FAM-CGCGACGTCAAACGCCACTACG-3'BHQ
ABCG2ForwardTTGGGTAATTTGTGCGTTA
ReverseCTACGAAAATCACCAAACGCTC
Probe5' FAM-TTAATCGCCGTCACTAACCGA-3'BHQ
BNIP3ForwardTAGGATTCGTTTCGCGTACG[37]
ReverseACCGCGTCGCCCATTAACCGCG
Probe5' FAM-CGTAAAATACGTATAACACGTACGAC-3'BHQ
β-actinForwardTGGTGATGGAGGAGGTTTAGTAAGT[34]
ReverseAACCAATAAAACCTACTCCTCCCTTAA
Probe5' FAM-ACCACCACCCAACACACAATAACAAACACA-3'BHQ
RNA extraction, conversion to cDNA and qRT-PCR

Total RNA was extracted from the 80 cell pellets using the ISOGEN kit (Nippon Gene, Toyama, Japan) according to the manufacturer’s instructions. Samples of RNA (100 ng) were converted into cDNA and amplified using the QuantiTect® Whole Transcriptome Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. In order to quantitatively estimate the expression level of CEA and CK19 mRNA, qRT-PCR was performed on a Light-Cycler™ instrument system (Roche, Mannheim, Germany) using LightCycler® TaqMan® Master (Roche, Mannheim, Germany) according to the manufacturer’s instructions. The primer sequences are shown in Table 2. After denaturing at 95°C for 10 min, qRT-PCR amplification was performed with 45 cycles of 15 s denaturing at 95°C, 5 s annealing at 60°C and a 10 s extension at 72°C. These experiments were all carried out in triplicate and the mean value was then calculated. The quantified value of mRNA expression of a target gene was normalized by β-actin.

Table 2 Primer and probe sequence of the LightCycler system for qRT-PCR.
GenePrimer sequence
CEAForwardAGTCTATGCAGAGCCACCCAA
ReverseGGGAGGCTCTGATTATTTACCCA
Probe5' FAM-ACCCTTCATCACCAGCAACAACTCCAA-3'BHQ
CK19ForwardGACATGCGAAGCCAATATGA
ReverseTCAGTAACCTCGGACCTGCT
Probe5' FAM-CTGGTTCACCAGCCGGACTGAAGAATT-3'BHQ
β-actinForwardCGAGCGCGGCTACAGCTT
ReverseTCCTTAATGTCACGCACGATTT
Probe5' FAM-ACCACCACGGCCGAGCGG-3'BHQ
Comparison of gene methylation between cancer tissue and peritoneal fluid

The conventional qualitative MSP was analyzed using several cancer tissue specimens. Genomic DNA was isolated from the tissue and bisulfite treatment was carried out as described above. The methylation status in the tissue samples was determined by MSP. Amplification was performed using Takara ExTaq Hot Start Version (Takara, Shiga, Japan) according to the manufacturer’s instructions. The primer sequences are shown in Table 1 and PCR was performed in an iCycler (Bio-Rad, Hercules, CA, USA) under the following conditions. After heating at 96°C for 3 min, 35 cycles at 96°C for 30 s, 60°C for 30 s, 72°C for 30 s and 72°C for 5 min. The PCR products were separated on 1.5% agarose gel, stained with ethidium bromide, and were then observed under ultraviolet light.

Statistical analysis

A cut-off value for distinguishing methylation status was determined using a receiver-operator characteristic (ROC) curve, which was obtained by comparing methylation values between group A and C. The cut-off value of CEA and CK19 mRNA expression was also determined by a ROC curve as described above. Differences in the frequencies were analyzed by the χ2 test, while also applying Fisher’s exact test. A statistical analysis was carried out using the SPSS 1.5 0j statistical software package for Windows (SPSS Japan Inc.). A P value of less than 0.05 was considered to be statistically significant.

RESULTS

The clinicopathological characteristics of the patients in this study are summarized in Table 3. The 80 patients included 28 (35.0%) females and 52 (65.0%) males with a mean age of 65.9 years (range, 39-88 years). The number of patients in group A, B and C was 35 (43.8%), 31 (38.8%) and 14 (17.5%) cases, respectively.

Table 3 Clinicopathological factors of the patients (n = 80).
Clinicopathological factorsn (%)
Gender
Female28 (35.0)
Male52 (65.0)
Age (yr)65.9 ± 10.8
Range39-88
Histological type
tub36 (45.0)
por/sig/muc44 (55.0)
Classification
Group A: M-MP with CY(-) and P(-)35 (43.8)
Group B: SS-SI with CY(-) and P(-)31 (38.8)
Group C: CY(+) or P(+)14 (17.5)
Clinical stage at the sample collection
I37 (46.3)
II8 (10.0)
III18 (22.5)
IV15 (18.8)
Peritoneal recurrence2 (2.5)
DNA hypermethylation of peritoneal fluids

Initially, q-MSP of CHFR, p16, RUNX3, E-cadherin, hMLH1, ABCG2 and BNIP3 was examined in 80 PFs. Figure 1 shows the methylation level of each gene in the 3 groups. The 80 cases were then divided into 2 groups, a methylation positive and a methylation negative group as described in the Materials & Methods section. Table 4 shows that the methylation status of CHFR, E-cadherin and BNIP3 were significantly different among the 3 groups (P < 0.05). In these 3 genes, the positive rate of methylation increased in order of group A, B and C. The correlation of multigene methylation among CHFR, E-cadherin and BNIP3 in the 3 groups was further analyzed. In group A and B, 3 of 35 cases (9%) and 6 of 31 cases (19%) showed multigene methylation in 2 or more genes, respectively (Table 5). In contrast, 8 of 14 cases (57%) were methylation positive in 2 or more genes in group C. The results showed a significant relationship between methylation status of more than 2 genes and the 3 groups (P < 0.001).

Figure 1
Figure 1 Methylation level of peritoneal wash specimens from gastric cancer patients measured by q-MSP according to the depth of cancer invasion and positive cancer cell findings. Left: Group A; Middle: Group B; Right: Group C.
Table 4 Relationship between the q-MSP results and depth of cancer invasion, CY and P classification n (%).
Methylation statusClassification
P-value
Group A: M-MP with CY(-) and P(-)Group B: SS-SI with CY(-) and P(-)Group C: CY(+) or P(+)
CHFR< 0.05
(-) 77 (96)35 (100)31 (100)11 (79)
(+) 3 (4)0 (0)0 (0)3 (21)
p160.821
(-) 33 (41)14 (40)14 (45)5 (36)
(+) 47 (59)21 (60)17 (55)9 (64)
RUNX30.304
(-) 36 (45)19 (54)11 (35)6 (43)
(+) 44 (55)16 (46)20 (65)8 (57)
E cadherin< 0.05
(-) 52 (65)28 (80)17 (55)7 (50)
(+) 28 (35)7 (20)14 (45)7 (50)
hMLH10.861
(-) 43 (54)20 (57)16 (52)7 (50)
(+) 37 (46)15 (43)15 (48)7 (50)
ABCG20.244
(-) 30 (38)12 (34)10 (32)8 (57)
(+) 50 (63)23 (66)21 (68)6 (43)
BNIP3< 0.05
(-) 50 (63)26 (74)20 (65)4 (29)
(+) 30 (38)9 (26)11 (35)10 (71)
Table 5 Correlation between the multigene methylation of the peritoneal wash specimens form gastric cancer and the depth of cancer invasion, CY and P classification n (%).
Multigene methylation (CHFR, E-cadherin, BNIP3)
P-value
Less than 2 genes2 or more genes
Classification
Group A: M-MP with CY(-) and P(-)32 (91)3 (9)< 0.001
Group B: SS-SI with CY(-) and P(-)25 (81)6 (19)
Group C: CY(+) or P(+)6 (43)8 (57)
mRNA expression of CEA and CK19 in peritoneal fluids

The expression of CEA and CK19 mRNAs in the 63 PFs were quantitatively analyzed by qRT-PCR to detect gastric cancer cells in the peritoneal washes. Figure 2 shows the expression level of CEA and CK19 mRNAs in the 3 groups. The mRNA level was further divided into negative and positive groups and compared among the 3 groups. The results showed that CK19, but not CEA, was significantly correlated with the 3 groups (Table 6, P < 0.05, P = 0.352). The positive rate of CK19 increased in order of group A (25%), B (46%) and C (73%).

Figure 2
Figure 2 mRNA expression level of peritoneal wash specimens from gastric cancer patients measured by qRT-PCR according to the depth of cancer invasion and positive cancer cell findings. Left: Group A; Middle: Group B; Right: Group C.
Table 6 Relationship between the qRT-PCR results and depth of cancer invasion, CY and P classification n (%).
Methylation statusClassification
P-value
Group A: M-MP with CY(-) and P(-)Group B: SS-SI with CY(-) and P(-)Group C: CY(+) or P(+)
CEA0.352
(-) 39 (62)17 (61)17 (71)5 (45)
(+) 24 (38)11 (39)7 (29)6 (55)
CK19< 0.05
(-) 37 (59)21 (75)13 (54)3 (27)
(+) 26 (41)7 (25)11 (46)8 (73)
Comparison of gene methylation between the cancer tissue and ascites fluid

The gene methylation of CHFR, E-cadherin and BNIP3 was examined in the primary or metastatic cancer tissue and was compared with those in the corresponding PF in group C. Nine of 14 cases were analyzed because the tissues were not obtained in remaining 5 cases. The same methylation pattern was present in the cancer tissues and ascites in 100% of CHFR, 88.9% of E-cadherin and 77.8% of BNIP3 (Table 7).

Table 7 Comparison of the methylation status between cancerous tissue and peritoneal fluid in group C.
Sample No.PathologyCYPExamined tissueMethylation status
Tissue
Peritoneal fluid
CHFRE-cadherinBNIP3CHFRE-cadherinBNIP3
A-03por+-Primary cancerNegativePositiveNegativeNegativePositiveNegative
A-09por+-Primary cancerNegativePositivePositiveNegativePositivePositive
A-16por++Primary cancerPositiveNegativePositivePositiveNegativePositive
A-29tub++Dissemination noduleNegativePositiveNegativeNegativePositivePositive
A-51por+-Metastatic lymph nodePositivePositivePositivePositivePositivePositive
A-59sig-+Primary cancerNegativePositivePositiveNegativeNegativeNegative
A-65por-+Metastatic ovarian tumorNegativePositivePositiveNegativePositivePositive
A-69sig++Primary cancerNegativePositivePositiveNegativePositivePositive
A-78tub+-Primary cancerNegativePositivePositiveNegativePositivePositive
Relationship between multigene methylation or mRNA expression and peritoneal recurrence

The prognosis of patients in group A or B was followed for at least 8 mo after surgery. None of the 35 patients in group A had cancer recurrence (data not shown). The prognosis of only 28 of 31 patients in group B was followed because the remaining 3 patients were excluded from this analysis based on the results of a non-curative resection. In 28 of the patients in group B, 2 of the 5 patients with multigene methylation showed peritoneal recurrence after surgery, while patients without or with a single gene methylation did not experience recurrent cancer (Table 8). There was a significant correlation between peritoneal recurrence and multigene methylation in group B (Table 8, P < 0.05). Peritoneal recurrence was observed in only 1 of 10 cases that were CK19 positive, however statistical significance was not observed (Table 8, P = 0.943).

Table 8 Correlation between peritoneal recurrence and multigene methylation and also the CK19 expression results in group B.
Multigene methylation (CHFR, E-cadherin, BNIP3)
P-valueCK19
P-value
Less than 2 genes2 or more genesNegativePositive
Peritoneal recurrence
Positive02< 0.05110.943
Negative233109
DISCUSSION

Postoperative recurrence of gastric cancer usually occurs in the peritoneum, lymph node and liver[1]. Peritoneal metastasis occurs most frequently and is highly resistant to various chemotherapies, which leads to a poor prognosis in gastric cancer patients. Peritoneal recurrence has been reported to depend on the depth of invasion, as 97.2% of recurrences occur beyond the MP. In addition, peritoneal recurrence was demonstrated in 34.9% of SS cases, 46.7% of SE cases and 60.0% of SI cases[2]. Another study reported that 50%-60% of gastric cancer patients with serosal invasion after a curative resection eventually developed peritoneal metastasis[38]. Furthermore, the average survival after peritoneal recurrence is 4.9 mo[39]. Therefore, the detection of micrometastasis in peritoneal lavage is essential, not only to make an accurate diagnosis, but also to start chemotherapy before the metastatic nodule is grossly formed in the peritoneum. The introduction of molecular technology such as RT-PCR of cancer specific genes has addressed the detection of micrometastasis in the LN[40,41], ascites[2,7-12,38,42,43], bone marrow and peripheral blood[44,45] in gastric cancer. Various types of mRNA, such as CEA, CK19, and CK20 have been analyzed by RT-PCR and used as molecular markers in detecting micrometastasis in gastric cancer. Several studies have reported that the positive expression of mRNA in PF shows a significant correlation with peritoneal recurrence and survival[2,8-12,38,43].

Recently, an analysis of cancer specific gene methylation has been utilized to detect micrometastasis in salivary rinses for head and neck cancer patients[18], pleural effusion for lung cancer and malignant mesothelioma[19], ductal fluid for breast cancer[24], ascites for ovarian cancer and colorectal cancer[21,22], bile for gallbladder cancer[25], pancreatic juice for pancreatic cancer[26], urine for prostate cancer[27], stool for colorectal cancer[28] and serum[20,29,30]. However, few studies have addressed gene methylation for the detection of micrometastasis to PF in gastrointestinal cancer[21].

The present study analyzed the promoter methylation of cancer related genes in 80 PFs. CHFR, p16, RUNX3, E-cadherin, hMLH1, ABCG2 and BNIP3 were chosen for the methylation analysis, because the frequent methylation of these 7 genes has been reported in several malignancies including gastric cancer[15,16,21,23,25-27,33-37,46-50]. Peritoneal recurrence has been reported to depend on the depth of invasion[2]. Therefore, 80 samples from gastric cancer patients were classified into 3 groups [Group A: cancer invasion was restricted in M, SM, MP, Group B: cancer invasion deeper than MP, Group C: CY(+) or P(+)] and correlated with the gene methylation. As a result, q-MSP analysis using the 80 PFs demonstrated that the methylation status of CHFR, E-cadherin and BNIP3 were significantly increased depending on the depth of cancer invasion. In contrast, the methylation status of the other genes was not significantly changed among the 3 groups (Table 4). These results indicate that the increasing value of the methylation of CHFR, E-cadherin and BNIP3 from group A to group C was possibly derived from the metastatic cancer cells in the peritoneum. On the other hand, a q-MSP analysis might detect methylation from normal cells in the peritoneum at the basal level in p16, RUNX3, hMLH1 and ABCG2 genes. Based on these findings, CHFR, E-cadherin and BNIP3 methylation was thus suggested to be preserved during cancer invasion, finally resulting in the occurrence of peritoneal seeding. Therefore, the methylation in more than 2 genes was compared among the 3 genes in each group. The results showed that there was a significant difference between multigene methylation and the 3 groups (Table 5). Eight of 14 patients (57%) in group C carried the multigene methylation while only 3 of 35 (9%) patients in group A exhibited multigene methylation. On the other hand, a qRT-PCR analysis examined the expression of CEA and CK19 mRNA in 63 samples (Table 6). Unexpectedly, CEA was not correlated with the classification even in group C with the highest positive rate. However, CK19 was significantly increased depending on the depth of cancer invasion, CY and P classification. It was desirable that gene methylation should be detected in up to 100% of samples in group C with CY1 or P1. However, only 21% of gene methylation was observed in CHFR, 46% of E-cadherin, 71% of BNIP3 and 57% of more than 2 genes were methylated in group C, indicating that gene methylation did not universally occur in all cancer cells. Thus, it is important to improve the sensitivity of multigene methylation analysis using PFs by increasing the number of genes that are specifically methylated in cancer cells. To clarify whether the methylation status of the PF originated from the cancer tissue, the methylation status of the primary or metastatic tissue in group C was compared with the methylation in the PF. The methylation status in the primary tumor was highly preserved in the PF (Table 7), thus suggesting that the methylation of the 3 genes assessed in the PF was derived from the primary tumor.

This study finally evaluated whether multigene methylation predicts peritoneal recurrence after surgery. In 21 patients in group B, peritoneal recurrence was found in 2 of 5 patients (40%) carrying multigene methylation. On the other hand, recurrence occurred in only 1 of 10 patients (10%) with positive CK19. There was a significant association between peritoneal recurrence and multigene methylation, but not CK19 (Table 8). These results suggested that multigene methylation may be a risk factor for peritoneal metastasis in the patients in group B even though the metastasis was not detected during surgery. An RT-PCR method using epithelial markers is critical in the diagnosis of micrometastasis. However, these methods only diagnose the presence of cancer cells. A methylation analysis that diagnosed micrometastasis in PFs would provide more information not only concerning the existence of cancer cells but also carcinogenesis, tumor progression and chemosensitivity, based on information on methylation status.

In conclusion, the present study investigated the methylation status in PF by both q-MSP and qRT-PCR analyses. The multigene methylation of CHFR, E-cadherin and BNIP in PF revealed the clinical feasibility of detecting occult neoplastic cells in the peritoneum. A methylation analysis along with a cytological examination might increase the positive detection of cancer cells in PF.

COMMENTS
Background

Postoperative recurrence of gastric cancer usually occurs in the peritoneum. Peritoneal recurrence is highly resistant to various chemotherapies, which leads to a poor prognosis in these patients. Therefore, the detection of micrometastasis in peritoneal lavage is essential, not only to make an accurate diagnosis, but also to start chemotherapy before the metastatic nodule is grossly formed in the peritoneum.

Research frontiers

Epigenetic gene silencing through DNA methylation occurs in various cancers. Recently, several reports have demonstrated aberrant gene methylation detected in various samples from cancer patients and have suggested the feasibility of methylation analysis in the evaluation of occult neoplastic cells or micrometastasis. This study clarified whether gene methylation in peritoneal fluid is feasible for determining micrometastasis to the peritoneum in gastric cancer patients.

Innovations and breakthroughs

Few studies have addressed gene methylation for the detection of micrometastasis to peritoneal fluid in gastrointestinal cancer. The authors’ results indicate that gene methylation in the peritoneal fluid could detect occult neoplastic cells in the peritoneum and might be a risk factor for peritoneal metastasis.

Applications

The development of this system may improve the accurate diagnosis of peritoneal dissemination and improve the prognosis of gastric cancer patients.

Terminology

DNA methylation is an epigenetic modification in humans, and changes in methylation patterns play an important role in carcinogenesis, cancer progression and chemosensitivity.

Peer review

This paper is interesting and written well.

References
1.  Yoo CH, Noh SH, Shin DW, Choi SH, Min JS. Recurrence following curative resection for gastric carcinoma. Br J Surg. 2000;87:236-242.  [PubMed]  [DOI]
2.  Fujiwara Y, Doki Y, Taniguchi H, Sohma I, Takiguchi S, Miyata H, Yamasaki M, Monden M. Genetic detection of free cancer cells in the peritoneal cavity of the patient with gastric cancer: present status and future perspectives. Gastric Cancer. 2007;10:197-204.  [PubMed]  [DOI]
3.  Benevolo M, Mottolese M, Cosimelli M, Tedesco M, Giannarelli D, Vasselli S, Carlini M, Garofalo A, Natali PG. Diagnostic and prognostic value of peritoneal immunocytology in gastric cancer. J Clin Oncol. 1998;16:3406-3411.  [PubMed]  [DOI]
4.  Mori K, Suzuki T, Uozaki H, Nakanishi H, Ueda T, Matsuno Y, Kodera Y, Sakamoto H, Yamamoto N, Sasako M. Detection of minimal gastric cancer cells in peritoneal washings by focused microarray analysis with multiple markers: clinical implications. Ann Surg Oncol. 2007;14:1694-1702.  [PubMed]  [DOI]
5.  Asao T, Fukuda T, Yazawa S, Nagamachi Y. Carcinoembryonic antigen levels in peritoneal washings can predict peritoneal recurrence after curative resection of gastric cancer. Cancer. 1991;68:44-47.  [PubMed]  [DOI]
6.  Yamamoto M, Baba H, Toh Y, Okamura T, Maehara Y. Peritoneal lavage CEA/CA125 is a prognostic factor for gastric cancer patients. J Cancer Res Clin Oncol. 2007;133:471-476.  [PubMed]  [DOI]
7.  Nakanishi H, Kodera Y, Yamamura Y, Ito S, Kato T, Ezaki T, Tatematsu M. Rapid quantitative detection of carcinoembryonic antigen-expressing free tumor cells in the peritoneal cavity of gastric-cancer patients with real-time RT-PCR on the lightcycler. Int J Cancer. 2000;89:411-417.  [PubMed]  [DOI]
8.  Kodera Y, Nakanishi H, Ito S, Yamamura Y, Fujiwara M, Koike M, Hibi K, Ito K, Tatematsu M, Nakao A. Prognostic significance of intraperitoneal cancer cells in gastric carcinoma: detection of cytokeratin 20 mRNA in peritoneal washes, in addition to detection of carcinoembryonic antigen. Gastric Cancer. 2005;8:142-148.  [PubMed]  [DOI]
9.  Ito S, Nakanishi H, Kodera Y, Mochizuki Y, Tatematsu M, Yamamura Y. Prospective validation of quantitative CEA mRNA detection in peritoneal washes in gastric carcinoma patients. Br J Cancer. 2005;93:986-992.  [PubMed]  [DOI]
10.  Wang JY, Lin SR, Lu CY, Chen CC, Wu DC, Chai CY, Chen FM, Hsieh JS, Huang TJ. Gastric cancer cell detection in peritoneal lavage: RT-PCR for carcinoembryonic antigen transcripts versus the combined cytology with peritoneal carcinoembryonic antigen levels. Cancer Lett. 2005;223:129-135.  [PubMed]  [DOI]
11.  Katsuragi K, Yashiro M, Sawada T, Osaka H, Ohira M, Hirakawa K. Prognostic impact of PCR-based identification of isolated tumour cells in the peritoneal lavage fluid of gastric cancer patients who underwent a curative R0 resection. Br J Cancer. 2007;97:550-556.  [PubMed]  [DOI]
12.  Tamura N, Iinuma H, Takada T. Prospective study of the quantitative carcinoembryonic antigen and cytokeratin 20 mRNA detection in peritoneal washes to predict peritoneal recurrence in gastric carcinoma patients. Oncol Rep. 2007;17:667-672.  [PubMed]  [DOI]
13.  Akiyama Y, Watkins N, Suzuki H, Jair KW, van Engeland M, Esteller M, Sakai H, Ren CY, Yuasa Y, Herman JG. GATA-4 and GATA-5 transcription factor genes and potential downstream antitumor target genes are epigenetically silenced in colorectal and gastric cancer. Mol Cell Biol. 2003;23:8429-8439.  [PubMed]  [DOI]
14.  Wen XZ, Akiyama Y, Baylin SB, Yuasa Y. Frequent epigenetic silencing of the bone morphogenetic protein 2 gene through methylation in gastric carcinomas. Oncogene. 2006;25:2666-2673.  [PubMed]  [DOI]
15.  Toyota M, Ahuja N, Suzuki H, Itoh F, Ohe-Toyota M, Imai K, Baylin SB, Issa JP. Aberrant methylation in gastric cancer associated with the CpG island methylator phenotype. Cancer Res. 1999;59:5438-5442.  [PubMed]  [DOI]
16.  Kitajima Y, Ohtaka K, Mitsuno M, Tanaka M, Sato S, Nakafusa Y, Miyazaki K. Helicobacter pylori infection is an independent risk factor for Runx3 methylation in gastric cancer. Oncol Rep. 2008;19:197-202.  [PubMed]  [DOI]
17.  Yu J, Cheng YY, Tao Q, Cheung KF, Lam CN, Geng H, Tian LW, Wong YP, Tong JH, Ying JM. Methylation of protocadherin 10, a novel tumor suppressor, is associated with poor prognosis in patients with gastric cancer. Gastroenterology. 2009;136:640-651.e1.  [PubMed]  [DOI]
18.  Carvalho AL, Jeronimo C, Kim MM, Henrique R, Zhang Z, Hoque MO, Chang S, Brait M, Nayak CS, Jiang WW. Evaluation of promoter hypermethylation detection in body fluids as a screening/diagnosis tool for head and neck squamous cell carcinoma. Clin Cancer Res. 2008;14:97-107.  [PubMed]  [DOI]
19.  Katayama H, Hiraki A, Aoe K, Fujiwara K, Matsuo K, Maeda T, Murakami T, Toyooka S, Sugi K, Ueoka H. Aberrant promoter methylation in pleural fluid DNA for diagnosis of malignant pleural effusion. Int J Cancer. 2007;120:2191-2195.  [PubMed]  [DOI]
20.  Ibanez de Caceres I, Battagli C, Esteller M, Herman JG, Dulaimi E, Edelson MI, Bergman C, Ehya H, Eisenberg BL, Cairns P. Tumor cell-specific BRCA1 and RASSF1A hypermethylation in serum, plasma, and peritoneal fluid from ovarian cancer patients. Cancer Res. 2004;64:6476-6481.  [PubMed]  [DOI]
21.  Kamiyama H, Noda H, Takata O, Suzuki K, Kawamura Y, Konishi F. Promoter hypermethylation of tumor-related genes in peritoneal lavage and the prognosis of patients with colorectal cancer. J Surg Oncol. 2009;100:69-74.  [PubMed]  [DOI]
22.  Köllermann J, Müller M, Goessl C, Krause H, Helpap B, Pantel K, Miller K. Methylation-specific PCR for DNA-based detection of occult tumor cells in lymph nodes of prostate cancer patients. Eur Urol. 2003;44:533-538.  [PubMed]  [DOI]
23.  Pellisé M, Castells A, Ginès A, Agrelo R, Solé M, Castellví-Bel S, Fernández-Esparrach G, Llach J, Esteller M, Bordas JM. Detection of lymph node micrometastases by gene promoter hypermethylation in samples obtained by endosonography- guided fine-needle aspiration biopsy. Clin Cancer Res. 2004;10:4444-4449.  [PubMed]  [DOI]
24.  Fackler MJ, Malone K, Zhang Z, Schilling E, Garrett-Mayer E, Swift-Scanlan T, Lange J, Nayar R, Davidson NE, Khan SA. Quantitative multiplex methylation-specific PCR analysis doubles detection of tumor cells in breast ductal fluid. Clin Cancer Res. 2006;12:3306-3310.  [PubMed]  [DOI]
25.  Klump B, Hsieh CJ, Dette S, Holzmann K, Kiebetalich R, Jung M, Sinn U, Ortner M, Porschen R, Gregor M. Promoter methylation of INK4a/ARF as detected in bile-significance for the differential diagnosis in biliary disease. Clin Cancer Res. 2003;9:1773-1778.  [PubMed]  [DOI]
26.  Matsubayashi H, Canto M, Sato N, Klein A, Abe T, Yamashita K, Yeo CJ, Kalloo A, Hruban R, Goggins M. DNA methylation alterations in the pancreatic juice of patients with suspected pancreatic disease. Cancer Res. 2006;66:1208-1217.  [PubMed]  [DOI]
27.  Rouprêt M, Hupertan V, Yates DR, Catto JW, Rehman I, Meuth M, Ricci S, Lacave R, Cancel-Tassin G, de la Taille A. Molecular detection of localized prostate cancer using quantitative methylation-specific PCR on urinary cells obtained following prostate massage. Clin Cancer Res. 2007;13:1720-1725.  [PubMed]  [DOI]
28.  Wang DR, Tang D. Hypermethylated SFRP2 gene in fecal DNA is a high potential biomarker for colorectal cancer noninvasive screening. World J Gastroenterol. 2008;14:524-531.  [PubMed]  [DOI]
29.  Abbaszadegan MR, Moaven O, Sima HR, Ghafarzadegan K, A'rabi A, Forghani MN, Raziee HR, Mashhadinejad A, Jafarzadeh M, Esmaili-Shandiz E. p16 promoter hypermethylation: a useful serum marker for early detection of gastric cancer. World J Gastroenterol. 2008;14:2055-2060.  [PubMed]  [DOI]
30.  Wang YC, Yu ZH, Liu C, Xu LZ, Yu W, Lu J, Zhu RM, Li GL, Xia XY, Wei XW. Detection of RASSF1A promoter hypermethylation in serum from gastric and colorectal adenocarcinoma patients. World J Gastroenterol. 2008;14:3074-3080.  [PubMed]  [DOI]
31.  Japanese Gastric Cancer Association. Japanese Classification of Gastric Carcinoma - 2nd English Edition -. Gastric Cancer. 1998;1:10-24.  [PubMed]  [DOI]
32.  Eads CA, Danenberg KD, Kawakami K, Saltz LB, Blake C, Shibata D, Danenberg PV, Laird PW. MethyLight: a high-throughput assay to measure DNA methylation. Nucleic Acids Res. 2000;28:E32.  [PubMed]  [DOI]
33.  Koga Y, Kitajima Y, Miyoshi A, Sato K, Sato S, Miyazaki K. The significance of aberrant CHFR methylation for clinical response to microtubule inhibitors in gastric cancer. J Gastroenterol. 2006;41:133-139.  [PubMed]  [DOI]
34.  Eads CA, Lord RV, Wickramasinghe K, Long TI, Kurumboor SK, Bernstein L, Peters JH, DeMeester SR, DeMeester TR, Skinner KA. Epigenetic patterns in the progression of esophageal adenocarcinoma. Cancer Res. 2001;61:3410-3418.  [PubMed]  [DOI]
35.  Cohen Y, Merhavi-Shoham E, Avraham RB, Frenkel S, Pe'er J, Goldenberg-Cohen N. Hypermethylation of CpG island loci of multiple tumor suppressor genes in retinoblastoma. Exp Eye Res. 2008;86:201-206.  [PubMed]  [DOI]
36.  Herman JG, Graff JR, Myöhänen S, Nelkin BD, Baylin SB. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA. 1996;93:9821-9826.  [PubMed]  [DOI]
37.  Okami J, Simeone DM, Logsdon CD. Silencing of the hypoxia-inducible cell death protein BNIP3 in pancreatic cancer. Cancer Res. 2004;64:5338-5346.  [PubMed]  [DOI]
38.  Broll R, Weschta M, Windhoevel U, Berndt S, Schwandner O, Roblick U, Schiedeck TH, Schimmelpenning H, Bruch HP, Duchrow M. Prognostic significance of free gastrointestinal tumor cells in peritoneal lavage detected by immunocytochemistry and polymerase chain reaction. Langenbecks Arch Surg. 2001;386:285-292.  [PubMed]  [DOI]
39.  Lee CC, Lo SS, Wu CW, Shen KH, Li AF, Hsieh MC, Lui WY. Peritoneal recurrence of gastric adenocarcinoma after curative resection. Hepatogastroenterology. 2003;50:1720-1722.  [PubMed]  [DOI]
40.  Kubota K, Nakanishi H, Hiki N, Shimizu N, Tsuji E, Yamaguchi H, Mafune K, Tange T, Tatematsu M, Kaminishi M. Quantitative detection of micrometastases in the lymph nodes of gastric cancer patients with real-time RT-PCR: a comparative study with immunohistochemistry. Int J Cancer. 2003;105:136-143.  [PubMed]  [DOI]
41.  Arigami T, Natsugoe S, Uenosono Y, Mataki Y, Ehi K, Higashi H, Arima H, Yanagida S, Ishigami S, Hokita S. Evaluation of sentinel node concept in gastric cancer based on lymph node micrometastasis determined by reverse transcription-polymerase chain reaction. Ann Surg. 2006;243:341-347.  [PubMed]  [DOI]
42.  Wang Z, Zhang X, Xu H, Zhou X, Jiang L, Lu C. Detection of peritoneal micrometastasis by reverse transcriptase-polymerase chain reaction for heparanase mRNA and cytology in peritoneal wash samples. J Surg Oncol. 2005;90:59-65.  [PubMed]  [DOI]
43.  Miyagawa K, Sakakura C, Nakashima S, Yoshikawa T, Fukuda K, Kin S, Nakase Y, Shimomura K, Oue N, Yasui W. Overexpression of RegIV in peritoneal dissemination of gastric cancer and its potential as A novel marker for the detection of peritoneal micrometastasis. Anticancer Res. 2008;28:1169-1179.  [PubMed]  [DOI]
44.  Fujita Y, Terashima M, Hoshino Y, Ohtani S, Kashimura S, Kanzaki N, Osuka F, Kogure M, Gotoh M. Detection of cancer cells disseminated in bone marrow using real-time quantitative RT-PCR of CEA, CK19, and CK20 mRNA in patients with gastric cancer. Gastric Cancer. 2006;9:308-314.  [PubMed]  [DOI]
45.  Mimori K, Fukagawa T, Kosaka Y, Ishikawa K, Iwatsuki M, Yokobori T, Hirasaki S, Takatsuno Y, Sakashita H, Ishii H. A large-scale study of MT1-MMP as a marker for isolated tumor cells in peripheral blood and bone marrow in gastric cancer cases. Ann Surg Oncol. 2008;15:2934-2942.  [PubMed]  [DOI]
46.  Nakano H, Nakamura Y, Soda H, Kamikatahira M, Uchida K, Takasu M, Kitazaki T, Yamaguchi H, Nakatomi K, Yanagihara K. Methylation status of breast cancer resistance protein detected by methylation-specific polymerase chain reaction analysis is correlated inversely with its expression in drug-resistant lung cancer cells. Cancer. 2008;112:1122-1130.  [PubMed]  [DOI]
47.  Kohya N, Koga Y, Kitajima Y, Miyazaki K. Aberrant promoter hypermethylation in biliary tract carcinoma. J Hepatobiliary Pancreat Surg. 2006;13:296-305.  [PubMed]  [DOI]
48.  Mitsuno M, Kitajima Y, Ide T, Ohtaka K, Tanaka M, Satoh S, Miyazaki K. Aberrant methylation of p16 predicts candidates for 5-fluorouracil-based adjuvant therapy in gastric cancer patients. J Gastroenterol. 2007;42:866-873.  [PubMed]  [DOI]
49.  Ide T, Kitajima Y, Ohtaka K, Mitsuno M, Nakafusa Y, Miyazaki K. Expression of the hMLH1 gene is a possible predictor for the clinical response to 5-fluorouracil after a surgical resection in colorectal cancer. Oncol Rep. 2008;19:1571-1576.  [PubMed]  [DOI]
50.  Koga Y, Kitajima Y, Miyoshi A, Sato K, Kitahara K, Soejima H, Miyazaki K. Tumor progression through epigenetic gene silencing of O(6)-methylguanine-DNA methyltransferase in human biliary tract cancers. Ann Surg Oncol. 2005;12:354-363.  [PubMed]  [DOI]
Footnotes

Peer reviewer: Toru Hiyama, MD, PhD, Health Service Center, Hiroshima University, 1-7-1 Kagamiyama, Higashihiroshima 739-8521, Japan

S- Editor Wang YR L- Editor Webster JR E- Editor Lin YP

Write to the Help Desk