BPG is committed to discovery and dissemination of knowledge
Original Article Open Access
©2009 The WJG Press and Baishideng. All rights reserved.
World J Gastroenterol. Feb 28, 2009; 15(8): 919-926
Published online Feb 28, 2009. doi: 10.3748/wjg.15.919
Aspirin increases susceptibility of Helicobacter pylori to metronidazole by augmenting endocellular concentrations of antimicrobials
Xiao-Ping Zhang, Wei-Hong Wang, Yu Tian, Wen Gao, Jiang Li, Department of Gastroenterology, Peking University First Hospital, Beijing 100034, China
Author contributions: Zhang XP performed most parts of the experiment and wrote the manuscript; Wang WH designed the study and wrote the manuscript; Tian Y, Gao W, Li J offered the technical assistance.
Correspondence to: Wei-Hong Wang, Department of Gastroenterology, Peking University First Hospital, Beijing 100034, China. wangweihong@medmail.com.cn
Telephone: +86-10-66551122
Fax: +86-10-66518105
Received: October 10, 2008
Revised: January 17, 2009
Accepted: January 24, 2009
Published online: February 28, 2009

Abstract

AIM: To investigate the mechanisms of aspirin increasing the susceptibility of Helicobacter pylori (H pylori) to metronidazole.

METHODS: H pylori reference strain 26 695 and two metronidazole-resistant isolates of H pylori were included in this study. Strains were incubated in Brucella broth with or without aspirin (1 mmol/L). The rdxA gene of H pylori was amplified by PCR and sequenced. The permeability of H pylori to antimicrobials was determined by analyzing the endocellular radioactivity of the cells after incubated with [7-3H]-tetracycline. The outer membrane proteins (OMPs) of H pylori 26 695 were depurated and analyzed by SDS-PAGE. The expression of 5 porins (hopA, hopB, hopC, hopD and hopE) and the putative RND efflux system (hefABC) of H pylori were analyzed using real-time quantitative PCR.

RESULTS: The mutations in rdxA gene did not change in metronidazole resistant isolates treated with aspirin. The radioactivity of H pylori increased when treated with aspirin, indicating that aspirin improved the permeability of the outer membrane of H pylori. However, the expression of two OMP bands between 55 kDa and 72 kDa altered in the presence of aspirin. The expression of the mRNA of hopA, hopB, hopC, hopD, hopE and hefA, hefB, hefC of H pylori did not change when treated with aspirin.

CONCLUSION: Although aspirin increases the susceptibility of H pylori to metronidazole, it has no effect on the mutations of rdxA gene of H pylori. Aspirin increases endocellular concentrations of antimicrobials probably by altering the OMP expression.

Key Words: Helicobacter pylori; Aspirin; Metronidazole; Resistance; Minimum inhibitory concentrations



INTRODUCTION

Aspirin, referred to as non-steroidal anti-inflammatory drugs (NSAIDs), is one of the most widely used drugs worldwide. It inhibits cyclooxygenases (COX), thereby irreversibly blocking the conversion of arachidonic acid to prostanoids. In addition, aspirin is also considered to offer some protection against coronary heart disease[1], due in part to inhibition of the thromboxane A2, a potent platelet aggregator. It has been reported that aspirin demonstrates chemopreventative activity against cancers in the esophagus, stomach and colon by inducing apoptosis in epithelial cells and regulating angiogenesis[24]. Aspirin also has numerous effects in different bacterial species. Previous studies reported that aspirin could inhibit the growth of some bacteria, affect the production of virulence factors of some bacteria, and alter the susceptibility of bacteria to some antibiotics by influencing the gene expression and inducing a number of morphological and physiological alterations in bacteria[5].

We previously reported that NSAIDs, including sodium salicylate, aspirin, indomethacin and celecoxib, inhibited the growth of H pylori in a dose-dependent manner when incubated in brucella broth in vitro[69]. These drugs also significantly affected the activity of virulence factors of H pylori, for example, urease and vaculating cytotoxin[89]. In addition, the minimum inhibitory concentrations (MICs) of clarithromycin, metronidazole and amoxicillin to H pylori decreased when treated with a low concentration of aspirin[68], indicating that aspirin increased the susceptibility of H pylori to these antimicrobials.

The aim of the present study was to investigate the mechanisms of aspirin increasing the susceptibility of H pylori to metronidazole. The rdxA gene of H pylori treated with and without aspirin was analyzed by PCR amplification and sequencing. The effect of aspirin on the permeability of the outer membrane of H pylori was determined using [7-3H]-tetracycline. The effects of aspirin on the expression of outer membrane proteins (OMPs) of H pylori were also determined.

MATERIALS AND METHODS
Chemicals

Aspirin (Sigma Chemical Co, St Louis, MO, USA) and proton conductor carbonyl cyanide m-chlorophenylhydrazone (CCCP, Sigma Chemical Co.) were dissolved in DMSO (Sigma Chemical Co.) in advance. [7-3H]-tetracycline (0.6 Ci/mmol; 22.2 GBq/mmol; Dupont/NEN Research Products, Boston, Mass.) was freshly dissolved in thin hydrochloric acid.

Strains and culture conditions

H pylori reference strain 26 695 (susceptible to metronidazole) and two clinical isolates of H pylori (metronidazole resistant, R1 and R2) were included in this study. Strains were cultured on Columbia agar plates containing 8% sheep blood in a microaerobic atmosphere (10% CO2 and 5% O2) at 37°C for 2-3 d. H pylori of 108 CFU/mL were then inoculated in 20 mL Brucella broth (Difco Laboratories, Detroit, MI, USA) supplemented with 10% fetal bovine serum (FBS; Gibco-BRL, Grand Island, NY, USA) in a set of 10 cm Petri dishes with 1 mmol/L aspirin or with vehicle control (DMSO 0.1%). Dishes were placed in an anaerobic jar (Oxoid) and incubated at 37°C on a shaker at 60 r/min under microaerobic conditions for 48 h.

Determination of MICs

Bacteria were prepared in Brain Heart Infusion broth to yield a viable count of 3×108 CFU/mL (equivalent to 1 McFarland turbidity standard unit) and used as the inocula for susceptibility testing. Bacterial suspension (100 &mgr;L) was spread, in duplicate, on Columbia agar plates with or without aspirin (1 mmol/L). A single E-test strip of metronidazole (OXOID Ltd, England) was applied to each plate. The MIC of metronidazole and the possible effect of aspirin on the MIC of metronidazole were determined after 72 h of incubation at 37°C under microaerobic conditions.

Extraction of genomic DNA

H pylori genomic DNA was extracted using silicon dioxicide method. Cells were harvested and washed twice in phosphate-buffered saline (PBS) (0.01 mol/L, pH 7.2). The cell precipitation was suspended in 100 &mgr;L TE. Then 5 &mgr;L SiO2 Liq. and 400 &mgr;L binding buffer (containing 4 mol/L guanidinium isothiocyanate, 50 mmol/L Tris-HCl, 20 mmol/L EDTA) was added and incubated at 55°C for 5 min with shaking once every minute. The suspension was centrifuged at 8000 r/min for 30 s at room temperature and the precipitate was washed thrice in cleaning buffer (containing 20 mmol/L Tris-HCl, 1 mmol/L EDTA, 100 mmol/L NaCl and dehydrated alcohol). The resulting suspension was dried at 55°C and stored at -20°C.

Amplification of H pylori rdxA gene and sequencing

The fragments (886 bp) containing the complete rdxA gene was amplified by PCR. Forward primer: 5'-AGGGATTTTATTGTATGCTACAA-3'; Reverse primer: 5'-AGGAGCATCAGATAGTTCTGA-3'. The PCR amplification was carried out in 25 &mgr;L reaction solution containing 2 &mgr;L of H pylori genomic DNA, 4.5 &mgr;L of 10 × PCR buffer (with 15 &mgr;mol/L MgCl2), 2 &mgr;L of dNTPs (each 2.5 mmol/L), 2 &mgr;L of forward and reverse primers (each 5 &mgr;mol/L), 0.5 &mgr;L of TaqDNA polymerase (1 U/&mgr;L) and 9 &mgr;L of ddH2O. The reaction was denatured initially at 94°C for 5 min, followed by 30 cycles, with each cycle composed of 30 s at 94°C (denaturation), 1 min at 52°C (annealing), and 1 min at 72°C (extension). After a final extension of 10 min at 72°C, the amplicons were electrophoresed in a 1.5% agarose gel and purified using the silicon dioxicide method as described above. The resulting rdxA gene was sequenced by the dideoxy chain termination procedure at Beijing Li-Jia-Tai-Cheng Technology Company. The rdxA genes of H pylori treated with and without aspirin were analyzed on line (http://align.genome.jp).

Uptake studies using [7-3H] tetracycline

Strain 26 695 was grown to mid-logarithmic phase (approximately from 3 × 109 to 5 × 109 CFU/mL) in Brucella broth and then 1 mmol/L of aspirin or DMSO (< 1%, vehicle control) were added for 6 h at 37°C on a shaker at 60 r/min under microaerobic condition. Cell suspension was centrifuged at 8000 r/min for 10 min at room temperature and the precipitate washed and suspended in HEPES buffer (pH 7.2, containing 100 &mgr;mol/L MgCl2). At room temperature, 5 &mgr;Ci [7-3H]-tetracycline (0.6 Ci/mmol; 22.2 GBq/mmol; Dupont/NEN Research Products, Boston, USA) was added to 10 mL cell suspension. After 20 min, each cell suspension was divided into two halves, and 100 &mgr;mol/L CCCP was added to one half. One milliliter aliquots were taken at 10 min intervals and washed three times in PBS. The resulting pellets were then diluted scintillation fluid and analyzed for radioactivity in an scintillation counter (TRI-CARB 2100TR).

Purification of OMPs

H pylori 26 695 was incubated in Brucella broth for 48 h. The suspension was centrifuged at 8000 r/min for 10 min, washed, and suspended in ice-cold Tris-Mg buffer (10 mmol/L Tris-HCl containing 5 mmol/L MgCl2, pH 7.3) and sonicated (once 30 s at 3-5 s interval for 5 min) until most of the cells were disrupted as visualized microscopically. Unbroken cells were removed by centrifugation at 8000 r/min for 20 min at 4°C. The inner and outer membranes were concentrated by centrifugation at 50 000 r/min for 60 min at 4°C. The precipitate was suspended in 2% Triton Tris-Mg (pH 7.5) and incubated for 30 min at room temperature, and then centrifuged and incubated again under the same condition. The resulting pellets, OMPs, were washed twice in 10 mmol/L Tris-HCl and resolved in ddH2O. The final concentration of OMPs was determined by Coomassie brilliant blue R250 method.

SDS-PAGE gel electrophoresis

Ten microgram OMPs were used for SDS-PAGE gel electrophoresis at permanent voltage (5% stacking gel at 60 V, 10% separating gel at 100 V). After incubation for 30 min in fixing liquid, the gel was dyed with Coomassie brilliant blue G250 for 30 min.

Isolation of total RNA and reverse transcription

Total RNA was obtained by the TRIzol method as described by manufacturer (Invitrogen, Burlington, Ontario, Canada), and the contaminating DNA was removed by DNase I treatment according to the manufacturer (Sigma). For cDNA synthesis, 4 &mgr;g RNA diluted with DEPC H2O was heated to 70°C for 5 min and chilled quickly on ice for 15 min. The samples were then added to a 20 &mgr;L reaction mixture containing 2 &mgr;L random hexameric primers (1 &mgr;g/&mgr;L), 0.4 &mgr;L of RNasin, 1 &mgr;L of M-MLV, 4 &mgr;L of dNTPs (each 2.5 mmol/L) and 4 &mgr;L of 5 × RT buffer. The cDNA synthesis reaction was performed for 60 min at 37°C. The enzyme was subsequently inactivated at 95°C for 5 min. Aliquots of cDNA were stored at -70°C.

Real-time quantitative PCR

The mRNA levels of hopA, hopB, hopC, hopD, hopE and hefA, hefB, hefC were determined by real-time PCR using an ABI Prism 7700 sequence detection system (Perkin-Elmer Applied Biosystems, Foster City, CA.). Specific primers and TaqMan probes were designed with the aid of the Primer Express program 3.0 (Perkin-Elmer Applied Biosystems) (Table 1). A standard curve was constructed using 10-fold serial dilutions of each cDNA. Reaction mixtures for PCR (50 &mgr;L) were prepared by mixing 5 &mgr;L synthesized cDNA solution with 5 &mgr;L of 10 × PCR buffer (containing 15 &mgr;mol/L MgCl2), 3 &mgr;L forward and reverse primers (each 5 &mgr;mol/L), 4 &mgr;L dNTPs (each 2.5 mmol/L), 2 &mgr;L TagMan probe, 1 &mgr;L of ROX, 0.5 &mgr;L TaqDNA polymerase (1 U/&mgr;L). PCR was carried out at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 60 s according to the manufacturers’ instructions. The levels of the protein mRNA were expressed as the ratio of the protein mRNA to 16S rRNA mRNA [protein mRNA (U/mL)/16S rRNA mRNA (U/mL) ratio × 100 000]. The PCR was carried out in quintuple using samples prepared at the same time.

Table 1 Primers and probes used in real-time quantitative PCR.
Probe or primer typeSequence (5'-3')
hopA FATCATGCTAGTGATGGCGTTAAAG
hopA RCAGGCATAGACGGAGGCAAT
hopA ProbeCCAAAAATATTGCATGCGTTCCCGC
hopB FCTTGGTGCAAAACATCGTCAAT
hopB RCCCGCCATAGCTCACTTGAT
hopB ProbeTAACGCTAGCCAACAACGCTAACATCAGCA
hopC FCGCTCTTTATAACGCGCAAGTAA
hopC RGCTGTTCCCGGCTCTGAAT
hopC ProbeTGGATAAAATCAACGCGCTCAACAATCAG
hopD FCTGCTTGAGCGCGGTTTAA
hopD RCAACCTAGACACTGGGAAAGCAT
hopD ProbeCTTGCGCTCTAGCGTTAGCGAACATGC
hopE FGGATTGCACAGGGAGTGTTGT
hopE RGCCCCATTAGCGTATTTAGCAT
hopE ProbeTTGCCCCCCAGGTCTTACCGCT
hefA FAGGGCGTTTTGGGAATTTCT
hefA RGCATGATGGATTGTTTTTGCA
hefA ProbeCCCCGGTCAGCAAAATACGGCTG
hefB FAGGGCGATGTTTTGTTGCTT
hefB ICCCCCAATTTTGCTGTATCGT
hefB ProbeAATCAAGACAAACAGGCTCAAAGCGATTCC
hefC FGTTTGCGTTCTTGCGTAACG
hefC RTGTTTAATGAAAAGCCCATCCA
hefC ProbeCACGATCACCCTCGTTTCAGCGATC
16S rRNA FCCGCCTACGCGCTCTTTAC
16S rRNA RCTAACGAATAAGCACCGGCTAAC
16S rRNA ProbeCCCAGTGATTCCGAGTAACGCTTGCA
Statistical analysis

Statistical analysis was performed using SPSS, 13.0. Representative data of endocellular radioactivity and quantitative PCR were presented as mean ± SD. The Student’s t test was used to compare data. P < 0.05 was considered statistically significant.

RESULTS
Effects of aspirin on MICs of metronidazole

For strain R1, MIC of metronidazole decreased from 256 &mgr;g/mL to 0.25 &mgr;g/mL in the presence of aspirin (1 mmol/L), and for strain R2, MIC of metronidazole reduced from 64 &mgr;g/mL to below the readable value (0.016 &mgr;g/mL), indicating that aspirin increased the susceptibility of H pylori to metronidazole and converted these two resistant strains to susceptible strains.

Effects of aspirin on mutations of rdxA gene

The 886 bp DNA fragments containing the complete rdxA gene were amplified by PCR for H pylori reference strain 26 695 and the two metronidazloe resistant strains (R1, R2) treated with or without aspirin. Sequence analysis revealed that there were point mutations, insertions and deletions in rdxA gene of strain R2 when compared with the reference strain 26 695, and the nucleotide homology between the two strains (26 695 and R2) was 94.4%. However, the nucleotide homology of rdxA gene between strain R2 and its corresponding isolate R2(A) (strain R2 treated with aspirin) was over 99.5% (Figure 1 and Figure 2).

Figure 1
Figure 1 Sequence comparison on line (http://align.genome.jp) of the rdxA gene between metronidazole resistant strain (R2) and H pylori reference strain 26 695 (S).
Figure 2
Figure 2 Sequence comparison on line (http://align.genome.jp) of the rdxA gene between metronidazole resistant strain (R2) and its corresponding susceptible strain in the presence of aspirin [R2 (A)].
Effects of aspirin on permeability of outer membrane of H pylori

Irrespective of the presence of CCCP, the radioactivity of H pylori treated with aspirin was higher when compared to that of the vehicle control (DMSO), indicating that aspirin enhanced the permeability of the outer membrane of H pylori to antimicrobial (Figure 3). Irrespective of the presence of aspirin, the radioactivity of H pylori cells decreased when the efflux pump inhibitor CCCP was added, indicating that aspirin did not interfere with the collapsion effect of CCCP on the proton gradient across the cytoplasmic membrane of H pylori (Figure 4).

Figure 3
Figure 3 Radioactivity of H pylori cells treated with aspirin (1 mmol/L) or vehicle control (DMSO). A: CCCP; B: No CCCP.
Figure 4
Figure 4 Radioactivity of H pylori cells treated with CCCP (100 µmol/L) or without CCCP. A: Aspirin; B: Vehicle control.
Effects of aspirin on OMP profiles

The OMP profiles of H pylori treated with aspirin were similar to that in control. However, the expression of two OMPs (Band 1 and 2) between 55 kDa and 72 kDa altered in the presence of aspirin (Figure 5).

Figure 5
Figure 5 OMP profiles of H pylori 26 695. M: Size marker; C: Control; D: DMSO; A: Aspirin. Band 1: OMP increased in the presence of aspirin; Band 2: OMP decreased in the presence of aspirin.
Effects of aspirin on expression of mRNA of porins and efflux system

Real-time quantitative PCR indicated that there was no significant difference in the levels of the cDNA of hopA, hopB, hopC, hopD, hopE and hefA, hefB, hefC for strains treated with aspirin when compared with that in control. This indicated that, irrespective of the presence of aspirin, the expression of the levels of mRNA of hopA, hopB, hopC, hopD, hopE and hefA, hefB, hefC did not change (Table 2).

Table 2 cDNAs levels of porins and efflux system of H pylori tested by real-time quantitative PCR.
Levels of cDNA
GeneAspirin groupDMSO controlBlank control
hopA963.60 ± 23.331087.75 ± 26.42856.27 ± 25.43
hopB84.00 ± 15.9791.45 ± 14.83100.15 ± 16.28
hopC52.98 ± 11.6751.77 ± 12.0152.79 ± 10.27
hopD83.86 ± 14.0992.46 ± 17.7889.92 ± 13.72
hopE54.07 ± 10.5852.77 ± 11.9352.12 ± 9.92
hefA12.31 ± 2.1212.51 ± 1.9912.97 ± 2.76
hefB25.47 ± 4.7328.48 ± 5.0725.60 ± 4.99
hefC55.62 ± 8.8952.08 ± 9.7853.37 ± 10.04
DISCUSSION

H pylori is a spiral-shaped gram-negative bacterium and an important human pathogen that colonizes in the stomach of 50% of the world human population[1011]. Infection results in chronic inflammation of the gastric mucosa and peptic ulcer, and it has been proven that H pylori infection is strongly associated with adenocarcinoma and mucosa-associated lymphoid tissue (MALT) lymphoma. International Agency for Research on Cancer affiliated to World Health Organization (WHO) defined H pylori as one of the first class human carcinogens[12]. Recent Studies revealed that H pylori infection plays important roles in the invasion of heart and brain vascular disorders, autoimmune diseases, nutritional and metabolic diseases, hematopathy and dermatologic diseases. Eradication of H pylori infection is very important to prevent and cure these diseases. The most successful treatment regimens use combinations of two or more antibiotics, such as amoxicillin, clarithromycin, metronidazole, or tetracycline, along with a proton pump inhibitor or bismuth. However, with the wide use of antimicrobials in clinical practice, antibiotic resistance is more and more apparent and is considered one of the major causes of treatment failure[13].

Early studies suggested that salicylate inhibited the growth of some bacteria, such as Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Staphylococcus epidermidis, and affected the activity of fimbriae, flagellum and the production of biofilm, slime, and thus might alter the pathogenicity of bacteria[1421]. It has been reported that in vitro, salicylate could alter the susceptibilities of bacteria to some antimicrobials. Salicylate induced the intrinsic multiple antimicrobial resistance phenotype in many bacteria, such as Escherichia coli, Salmonella typhimurium and Staphylococcus aureus, and increased the susceptibilities of some bacteria to aminoglycosides[2229]. Our previous studies also found that in vitro aspirin not only inhibited the growth of H pylori[69], but also decreased the MICs of metronidazole, clarithromycin and amoxicillin to H pylori, and even converted some resistant strains to susceptible ones[68]. Therefore, the present study investigated the mechanisms of aspirin increasing the susceptibility of H pylori to metronidazole.

At least four distinctive mechanisms of antibiotic resistance have been described in bacteria: enzymatic inactivation, decreased permeability of bacterial membranes, active efflux of antimicrobial agents, and alteration of target sites of antimicrobials to bacteria[30]. Metronidazole, clarithromycin and amoxicillin are different kinds of antimicrobials, and each has its different effect on different target site in H pylori. Likewise, resistance of H pylori to these antimicrobial agents arises through various mechanisms. A reasonable explanation of aspirin increasing the susceptibility of H pylori to antimicrobials with different antibacterial mechanisms is that aspirin does not alter the target sites of bacteria, but increases the endocellular concentrations of antimicrobials.

Metronidazole is a prodrug activated by nitrore-ductases in bacteria cells. Resistance of metronidazole is caused by either the absence or the inactivation of the nitroreductases[31]. It has been reported that the resistance of H pylori to metronidazole was mainly due to null mutations in the rdxA gene, which encoded an oxygen-insensitive NADPH nitroreductase[32]. However, studies also reported involvement of other reductases in the development of the resistant phenotype. In addition to oxygen-insensitive NADPH nitroreductases, several other nitroreductases in H pylori, such as NADPH flavin oxidoreductase, ferredoxin-like protein, flavodoxin, α-ketoglutarate oxidoreductase and pyruvate: flavodoxin oxidoreductase, have been found to reduce metronidazole and to generate active compounds[3334]. In our study, mutations in rdxA gene might be involved for the resistance of the isolated strain (R2). However, in the presence of aspirin, the strain converted from metronidazole resistant to susceptible, while the mutations in rdxA gene did not change. By using isotope scintillation technique with [7-3H]-tetracycline, our study revealed that aspirin increased the endocellular concentration of antimicrobials in H pylori cells, indicating that aspirin increased the outer membrane permeability of H pylori to antimicrobials. With the higher endocellular concentration in the presence of aspirin, metronidazole might be reduced and activated by other nitroreductases in H pylori. Therefore, the MIC of H pylori to metronidazole decreased, and in some circumstances, resistant strains even converted to susceptible ones.

Two pathways may be involved in the mechanisms for the increasing concentration of antimicrobials in bacteria cells. One is the augmentation of anti-microbials entering into the bacteria cells passively; the other is the impairment of antimicrobials pumping out of the bacteria actively. Previous studies on Escherichia coli revealed that salicylate increased resistance to multiple antibiotics, including quinolones, cephalosporins, ampicillin, nalidixic acid, tetracycline and chloramphenicol[22]. Aspirin could induce multiple antibiotic resistance (mar) gene, alter the expression of OMPs, and decrease the outer membrane permeability to antimicrobials or increase the efflux of antimicrobials[3538]. There were three basic uptake systems across the outer membrane[39], namely, uptake of hydrophilic substances through the water-filled channels of porins, uptake of polycations via self-promoted uptake at divalent cation binding sites on lipopolysaccharide, and uptake of hydrophobic substances through the outer membrane bilayer. Bacteria could produce many porins, and were able to regulate the relative number of different porins in response to the osmolarity of the surrounding media. At least five porins named HopA, HopB, HopC, HopD and HopE (part of a 32-member family of outer membrane proteins) were present in a single cell of H pylori[4041]. These porins were considered to be associated with antibiotic resistance[40]. On the other hand, some bacteria expressed a membrane transporter system that led to multidrug resistance by drug efflux. Three putative RND efflux systems, HefABC, HefDEF and HefGHI, identified in H pylori may be correlated with antibiotic resistance[42]. Of the three efflux systems, only HefABC was involved in multidrug resistance in vitro[42]. Therefore, we tested the five porin genes (hopA, hopB, hopC, hopD and hopE) and the efflux protein genes (hefA, hefB, hefC) using real-time quantitative PCR, and found that aspirin did not interfere with the expression of the above proteins at the levels of gene transcription.

The alteration of the permeability of outer membrane of H pylori should be accompanied by the modification of some related OMPs. In the present study, the expression of two OMPs of H pylori between 55 kDa and 72 kDa altered in the presence of aspirin. However, the functions and identifications of these OMPs need to be determined by two-dimensional electrophoresis and protein mass-spectrum analysis. If these OMPs were associated with the increase of the permeability of outer membrane of H pylori, further studies should be performed to determine whether the functional and phenotypic alterations of these OMPs in the presence of aspirin occurred at the levels of protein translation or modification, or some other porins or efflux systems were involved.

Park et al[43] conducted a pilot study aimed at comparing the efficacy of the standard omeprazole-amoxicillin-clarithromycin (OAC) regimen with a combined OAC regimen and aspirin (OACA). Follow-up endoscopic findings showed that the previous ulcers were completely healed in all subjects. Although the eradication rate for the OACA group (86.7%) was higher than that of the OAC group (80.3%), there was no statistically significant difference between the two groups. The overall adverse events were similar in the two groups. The OACA regimen was well tolerated in the group of patients with peptic ulcer disease. The potential of aspirin and other NSAIDs for clinical use to augment the efficacy of H pylori eradication may warrant further investigations.

With the increasing attention paid to the detriment of H pylori and the resistance of antimicrobials to this microorganism, it is urgent to investigate new effective therapeutic regimens. Investigating the molecule mechanisms of aspirin increasing the susceptibility of H pylori to antimicrobials will help discover a more effective eradication regimen in clinical practice.

COMMENTS
Background

It was reported that aspirin inhibited the growth of Helicobacter pylori (H pylori) and the minimal inhibitory concentration (MICs) of clarithromycin, metronidazole and amoxicillin to H pylori decreased when treated with aspirin. This indicated that aspirin increased the susceptibility of H pylori to these antimicrobials, and even converted some resistant strains to susceptible ones.

Research frontiers

H pylori infection results in chronic inflammation of gastric mucosa, peptic ulcer and is strongly associated with adenocarcinoma and mucosa-associated lymphoid tissue (MALT) lymphoma. Recent research revealed that H pylori infection played important roles in the invasion of heart and brain vascular disorders, autoimmune diseases, nutritional and metabolic diseases, hematopathy and dermatologic diseases. Eradication of H pylori infection is, therefore, very important to prevent and cure these diseases. However, with the wide use of antimicrobials in clinical practice, antibiotic resistance has become apparent and is considered one of the major causes of treatment failure.

Innovations and breakthroughs

In vitro, aspirin decreased the MICs of metronidazole, clarithromycin and amoxicillin to H pylori, and even converted some resistant strains to susceptible ones. This study investigated the mechanisms of aspirin increasing the susceptibility of H pylori to metronidazole.

Applications

Investigating the molecule mechanisms of aspirin increasing the susceptibility of H pylori to antimicrobials will help understand the mechanisms of the resistance of H pylori to antibiotics more intensively and discover a more effective eradication regimen in clinical practice.

Terminology

Carbonyl cyanide m-chlorophenylhydrazone (CCCP), a kind of efflux pump inhibitor that is effective at a micromolar concentration, can alter the pH gradient across the cytoplasmic membrane, therefore, deprives the energy provision of the transport protein.

Peer review

The authors intensively reported that non-steroidal anti-inflammatory drugs (NSAIDs), including sodium salicylate, aspirin, indomethacin and celecoxib, inhibited the growth of H pylori in a dose-dependent manner and changed the susceptibility of H pylori to antibiotics. In this study, the authors demonstrated that although aspirin increased the susceptibility of H pylori to metronidazole, it had no effect on the mutations of rdxA gene of H pylori and that aspirin increased endocellular concentrations of antimicrobials probably by altering the outer membrane proteins (OMPs) expression of H pylori. This theme is interesting, and will give new insights of H pylori eradication for physicians.

References
1.  Kagawa A, Azuma H, Akaike M, Kanagawa Y, Matsumoto T. Aspirin reduces apolipoprotein(a) (apo(a)) production in human hepatocytes by suppression of apo(a) gene transcription. J Biol Chem. 1999;274:34111-34115.  [PubMed]  [DOI]
2.  Morgan G. Non-steroidal anti-inflammatory drugs and the chemoprevention of colorectal and oesophageal cancers. Gut. 1996;38:646-648.  [PubMed]  [DOI]
3.  Peleg II, Lubin MF, Cotsonis GA, Clark WS, Wilcox CM. Long-term use of nonsteroidal antiinflammatory drugs and other chemopreventors and risk of subsequent colorectal neoplasia. Dig Dis Sci. 1996;41:1319-1326.  [PubMed]  [DOI]
4.  Vainio H, Morgan G, Kleihues P. An international evaluation of the cancer-preventive potential of nonsteroidal anti-inflammatory drugs. Cancer Epidemiol Biomarkers Prev. 1997;6:749-753.  [PubMed]  [DOI]
5.  Price CT, Lee IR, Gustafson JE. The effects of salicylate on bacteria. Int J Biochem Cell Biol. 2000;32:1029-1043.  [PubMed]  [DOI]
6.  Wang WH, Hu FL, Wong BCY, Berg DE, Lam SK. Inhibitory effects of aspirin and indometacin on the growth of Helicobacter pylori in vitro. Chin J Dig Dis. 2002;3:172-177.  [PubMed]  [DOI]
7.  Wang WH, Wong WM, Dailidiene D, Berg DE, Gu Q, Lai KC, Lam SK, Wong BC. Aspirin inhibits the growth of Helicobacter pylori and enhances its susceptibility to antimicrobial agents. Gut. 2003;52:490-495.  [PubMed]  [DOI]
8.  Gu Q, Xia HH, Wang WH, Wang JD, Wong WM, Chan AO, Yuen MF, Lam SK, Cheung HK, Liu XG. Effect of cyclo-oxygenase inhibitors on Helicobacter pylori susceptibility to metronidazole and clarithromycin. Aliment Pharmacol Ther. 2004;20:675-681.  [PubMed]  [DOI]
9.  Ma HX, Wang WH, Hu FL, Li J. Effect of aspirin and celecoxib on Helicobacter pylori in vitro. Shijie Huaren Xiaohua Zazhi. 2006;14:2747-2752.  [PubMed]  [DOI]
10.  Walker MM, Crabtree JE. Helicobacter pylori infection and the pathogenesis of duodenal ulceration. Ann N Y Acad Sci. 1998;859:96-111.  [PubMed]  [DOI]
11.  Telford JL, Covacci A, Rappuoli R, Chiara P. Immunobiology of Helicobacter pylori infection. Curr Opin Immunol. 1997;9:498-503.  [PubMed]  [DOI]
12.  Vandenplas Y. Helicobacter pylori infection. World J Gastroenterol. 2000;6:20-31.  [PubMed]  [DOI]
13.  Graham DY. Therapy of Helicobacter pylori: current status and issues. Gastroenterology. 2000;118:S2-S8.  [PubMed]  [DOI]
14.  Kunin CM, Hua TH, Guerrant RL, Bakaletz LO. Effect of salicylate, bismuth, osmolytes, and tetracycline resistance on expression of fimbriae by Escherichia coli. Infect Immun. 1994;62:2178-2186.  [PubMed]  [DOI]
15.  Farber BF, Wolff AG. The use of salicylic acid to prevent the adherence of Escherichia coli to silastic catheters. J Urol. 1993;149:667-670.  [PubMed]  [DOI]
16.  Kunin CM, Hua TH, Bakaletz LO. Effect of salicylate on expression of flagella by Escherichia coli and Proteus, Providencia, and Pseudomonas spp. Infect Immun. 1995;63:1796-1799.  [PubMed]  [DOI]
17.  Farber BF, Hsieh HC, Donnenfeld ED, Perry HD, Epstein A, Wolff A. A novel antibiofilm technology for contact lens solutions. Ophthalmology. 1995;102:831-836.  [PubMed]  [DOI]
18.  Muller E, Al-Attar J, Wolff AG, Farber BF. Mechanism of salicylate-mediated inhibition of biofilm in Staphylococcus epidermidis. J Infect Dis. 1998;177:501-503.  [PubMed]  [DOI]
19.  Teichberg S, Farber BF, Wolff AG, Roberts B. Salicylic acid decreases extracellular biofilm production by Staphylococcus epidermidis: electron microscopic analysis. J Infect Dis. 1993;167:1501-1503.  [PubMed]  [DOI]
20.  Domenico P, Schwartz S, Cunha BA. Reduction of capsular polysaccharide production in Klebsiella pneumoniae by sodium salicylate. Infect Immun. 1989;57:3778-3782.  [PubMed]  [DOI]
21.  Salo RJ, Domenico P, Tomás JM, Straus DC, Merino S, Benedí VJ, Cunha BA. Salicylate-enhanced exposure of Klebsiella pneumoniae subcapsular components. Infection. 1995;23:371-377.  [PubMed]  [DOI]
22.  Rosner JL. Nonheritable resistance to chloramphenicol and other antibiotics induced by salicylates and other chemotactic repellents in Escherichia coli K-12. Proc Natl Acad Sci USA. 1985;82:8771-8774.  [PubMed]  [DOI]
23.  Cohen SP, McMurry LM, Hooper DC, Wolfson JS, Levy SB. Cross-resistance to fluoroquinolones in multiple-antibiotic-resistant (Mar) Escherichia coli selected by tetracycline or chloramphenicol: decreased drug accumulation associated with membrane changes in addition to OmpF reduction. Antimicrob Agents Chemother. 1989;33:1318-1325.  [PubMed]  [DOI]
24.  Sulavik MC, Dazer M, Miller PF. The Salmonella typhimurium mar locus: molecular and genetic analyses and assessment of its role in virulence. J Bacteriol. 1997;179:1857-1866.  [PubMed]  [DOI]
25.  Domenico P, Hopkins T, Cunha BA. The effect of sodium salicylate on antibiotic susceptibility and synergy in Klebsiella pneumoniae. J Antimicrob Chemother. 1990;26:343-351.  [PubMed]  [DOI]
26.  Gustafson JE, Candelaria PV, Fisher SA, Goodridge JP, Lichocik TM, McWilliams TM, Price CT, O'Brien FG, Grubb WB. Growth in the presence of salicylate increases fluoroquinolone resistance in Staphylococcus aureus. Antimicrob Agents Chemother. 1999;43:990-992.  [PubMed]  [DOI]
27.  Price CT, O'Brien FG, Shelton BP, Warmington JR, Grubb WB, Gustafson JE. Effects of salicylate and related compounds on fusidic acid MICs in Staphylococcus aureus. J Antimicrob Chemother. 1999;44:57-64.  [PubMed]  [DOI]
28.  Domenico P, Straus DC, Woods DE, Cunha BA. Salicylate potentiates amikacin therapy in rodent models of Klebsiella pneumoniae infection. J Infect Dis. 1993;168:766-769.  [PubMed]  [DOI]
29.  Aumercier M, Murray DM, Rosner JL. Potentiation of susceptibility to aminoglycosides by salicylate in Escherichia coli. Antimicrob Agents Chemother. 1990;34:786-791.  [PubMed]  [DOI]
30.  Messier N, Roy PH. Integron integrases possess a unique additional domain necessary for activity. J Bacteriol. 2001;183:6699-6706.  [PubMed]  [DOI]
31.  Edwards DI. Nitroimidazole drugs--action and resistance mechanisms. I. Mechanisms of action. J Antimicrob Chemother. 1993;31:9-20.  [PubMed]  [DOI]
32.  Goodwin A, Kersulyte D, Sisson G, Veldhuyzen van Zanten SJ, Berg DE, Hoffman PS. Metronidazole resistance in Helicobacter pylori is due to null mutations in a gene (rdxA) that encodes an oxygen-insensitive NADPH nitroreductase. Mol Microbiol. 1998;28:383-393.  [PubMed]  [DOI]
33.  Jenks PJ, Edwards DI. Metronidazole resistance in Helicobacter pylori. Int J Antimicrob Agents. 2002;19:1-7.  [PubMed]  [DOI]
34.  Mendz GL, Mégraud F. Is the molecular basis of metronidazole resistance in microaerophilic organisms understood? Trends Microbiol. 2002;10:370-375.  [PubMed]  [DOI]
35.  Ma D, Cook DN, Alberti M, Pon NG, Nikaido H, Hearst JE. Genes acrA and acrB encode a stress-induced efflux system of Escherichia coli. Mol Microbiol. 1995;16:45-55.  [PubMed]  [DOI]
36.  Fralick JA. Evidence that TolC is required for functioning of the Mar/AcrAB efflux pump of Escherichia coli. J Bacteriol. 1996;178:5803-5805.  [PubMed]  [DOI]
37.  Rosner JL, Chai TJ, Foulds J. Regulation of ompF porin expression by salicylate in Escherichia coli. J Bacteriol. 1991;173:5631-5638.  [PubMed]  [DOI]
38.  Hancock RE. The bacterial outer membrane as a drug barrier. Trends Microbiol. 1997;5:37-42.  [PubMed]  [DOI]
39.  Doig P, Exner MM, Hancock RE, Trust TJ. Isolation and characterization of a conserved porin protein from Helicobacter pylori. J Bacteriol. 1995;177:5447-5452.  [PubMed]  [DOI]
40.  Exner MM, Doig P, Trust TJ, Hancock RE. Isolation and characterization of a family of porin proteins from Helicobacter pylori. Infect Immun. 1995;63:1567-1572.  [PubMed]  [DOI]
41.  Bina JE, Nano F, Hancock RE. Utilization of alkaline phosphatase fusions to identify secreted proteins, including potential efflux proteins and virulence factors from Helicobacter pylori. FEMS Microbiol Lett. 1997;148:63-68.  [PubMed]  [DOI]
42.  Bina JE, Alm RA, Uria-Nickelsen M, Thomas SR, Trust TJ, Hancock RE. Helicobacter pylori uptake and efflux: basis for intrinsic susceptibility to antibiotics in vitro. Antimicrob Agents Chemother. 2000;44:248-254.  [PubMed]  [DOI]
43.  Park SH, Park DI, Kim SH, Kim HJ, Cho YK, Sung IK, Sohn CI, Jeon WK, Kim BI, Keum DK. Effect of high-dose aspirin on Helicobacter pylori eradication. Dig Dis Sci. 2005;50:626-629.  [PubMed]  [DOI]
Footnotes

Supported by The National Natural Science Foundation of China, No. 30470777

Write to the Help Desk