BPG is committed to discovery and dissemination of knowledge
Rapid Communication Open Access
©2008 The WJG Press and Baishideng. All rights reserved.
World J Gastroenterol. Oct 7, 2008; 14(37): 5749-5754
Published online Oct 7, 2008. doi: 10.3748/wjg.14.5749
Expression of Livin and vascular endothelial growth factor in different clinical stages of human esophageal carcinoma
Li Chen, Department of Thoracic Surgery, the First Affiliated Hospital of Chongqing Medical University, Chongqing 400016, China
Guo-Sheng Ren, Fan Li, Department of General Surgery, the First Affiliated Hospital of Chongqing Medical University, Chongqing 400016, China
Shan-Quan Sun, Anatomy institution of Chongqing Medical University, Chongqing 400016, China
Author contributions: Ren GS and Chen L contributed equally to this work; Chen L and Sun SQ designed research; Chen L and Li F performed research; Chen L contributed new reagents/analytic tools; Li F analyzed data; and Chen L and Ren GS wrote the paper.
Correspondence to: Guo-Sheng Ren, Department of General Surgery, the First Affiliated Hospital of Chongqing Medical Uni-versity, Chongqing 400016, China. renguosheng726@163.com
Telephone: +86-23-89012301 Fax: +86-23-68120808
Received: July 18, 2008
Revised: August 24, 2008
Accepted: August 31, 2008
Published online: October 7, 2008

Abstract

AIM: To investigate the role of Livin and vascular endothelial growth factor (VEGF) in human esophageal carcinoma, and analyze its relationship to clinical stages.

METHODS: Expression of Livin in fresh esophageal cancer tissues was detected by immunohistochemistry (IHC), Western blotting and reverse transcriptase-polymerase chain reaction (RT-PCR), and VEGF by Western blotting and RT-PCR. All statistical analyses were performed by SPSS version 11.0.

RESULTS: Livin positivity was also significantly correlated with tumor stages, increasing with tumor progression. Expression of Livin and VEGF increased with the process of esophageal carcinoma. In the fourth clinical stage, expression of Livin and VEGF was the most significant. Expression of Livin was positively correlated with VEGF.

CONCLUSION: Over-expression of Livin and VEGF contributes to the pathogenesis of esophageal carcinoma.

Key Words: Esophageal carcinoma; Livin; Vascular endothelial growth factor



INTRODUCTION
Table 1 Oligonucleotides used for reverse transcriptase-polymerase chain reaction.
Target genePrimer sequence (5’-3’)Size (bp)Annealing temperature (°C)
β-actinForward: GTTCGCCATGGATGACGATATC26659
Reverse: GCCAGATCTTCTCCATGTCGTC
VEGFForward: TGCTCAGCATTCGGACTGACCT22861
Reverse: CAGTATGCATGGACCATGACGG
LivinForward: CTGGTCAGAGCCAGTGTTCCT31261
Reverse: TCATAGAAGGAGGCCAGACG
Figure 1
Figure 1 A: The expression of Livin was measured by IHC (SP × 400). Optical density value and positive cell percentage in clinicopathologic stage two, three and four was significantly higher than that of stage one (bP < 0.01). Furthermore, optical density value and positive cell percentage in clinicopathologic stage four was significantly higher than that of stage two and three (dP < 0.01). IHC showed that Livin had significant expression in the cytoplasm and nucleus in the Stage II, III and IV (the cytoplasm and nucleus had stained yellow), slight expression in the cytoplasm and nucleus in Stage I (the cytoplasm and nucleus had slightly stained yellow); B: The expression of Livin by Western blotting showed that expression of Livin in clinicopathologic stage two, three and four was significantly higher than that of stage one (fP < 0.01). Optical density value and positive cell percentage in clinicopathologic stage four was significantly higher than that of stage two and three (hP < 0.01); C: mRNA level of Livin was tested by RT-PCR. Up-regulation of Livin gene transcription matched with the protein level of Livin that was significantly increased along with the progression of esophageal carcinoma. Optical density value in clinicopathologic stage two, three and four was significantly higher than that of stage one (jP < 0.01). Optical density value and positive cell percentage in clinicopathologic stage four was significantly higher than that of stage two and three (lP < 0.01).
Figure 2
Figure 2 Assay of level of VEGF. A: The expression of VEGF by Western blotting showed that expression of VEGF in clinicopathologic stage two, three and four was significantly higher than that of stage one (bP < 0.01). Optical density value in clinicopathologic stage two, three and four was significantly higher than that of stage one (bP < 0.01). Optical density value and positive cell percentage in clinicopathologic stage four was significantly higher than that of stage two and three (dP < 0.01); B: Up-regulation of VEGF gene transcription matched with the protein level of VEGF that was significantly increased along with the progression of esophageal carcinoma. Optical density value in clinicopathologic stage two, three and four was significantly higher than that of stage one (fP < 0.01). Optical density value and positive cell percentage in clinicopathologic stage four was significantly higher than that of stage two and three (hP < 0.01).

Livin, also known as inhibitor of apoptosis (IAP) has been identified as a new member of the IAP family proteins[1-3]. Like other IAP family proteins, Livin interacts with downstream caspases, such as caspase-3, caspase-7, and caspase-9, leading to their inactivation and degradation[4,5]. Its overexpression can protect cells from several proapoptotic stimuli. Very importantly, treatment of cancer cells with Livin antisense oligo-DNA causes apoptotic cell death, indicating that Livin expression may be essential for survival of certain cancer cells[6,7]. Vascular endothelial growth factor (VEGF) is a potent mitogen for endothelial cells, and its expression has been correlated with increased tumour angiogenesis[8,9]. VEGF plays a crucial role in tumour expansion by initiating permeabilization of blood vessels, by extravasation of plasma proteins, by invasion of stromal cells, and by causing the sprouting of new blood vessels that supply the tumour with oxygen and nutrients. A number of studies have shown that expression of certain VEGF transcripts are correlated with tumour progression[10]. Although increases of certain VEGF transcripts have been demonstrated to correlate with the progression of various tumours, the actual protein levels of the different VEGF isoforms and their significance during cellular transformation are unknown. Moreover, it has been suggested that elevated protein expression in tumour tissues was mediated by both enhanced transcription and translation. Thus, in order to understand the role of Livin and VEGF in tumour progression, it is important to investigate Livin and VEGF expression of different clinical stages at the protein and mRNA level during tumourigenesis. Esophageal carcinoma is one of the most frequent malignancies in many countries. Despite recent progress in chemotherapeutic, radiotherapeutic, and surgical treatment, the 5-year survival rate of esophageal carcinoma patients is still low, especially in advanced cases. In order to further explore the role of Livin and VEGF in the development of esophageal carcinoma, we investigated the role of Livin and VEGF in human esophageal carcinoma and analyze its relationship with clinical stages.

MATERIALS AND METHODS
Materials

Specimens of cancer tissues were taken from 67 consecutive patients with esophageal carcinoma from Oct 2004 to Sept 2005 at the Department of Thoracic Surgery, the First Affiliated Hospital of Chongqing Medical University. None of them received irradiation or chemotherapy preoperatively. The patients included 46 men and 21 women with a mean age of 57 ranges from 38-86 years. The clinicopathologic stage was determined according to TNM classification. Six tumors were located in the upper thorax, 6 cases for clinicopathologic stage one, 24 case clinicopathologic stage two, 28 cases clinicopathologic stage three, 9 cases clinicopathologic stage four. All fresh tissues were taken immediately after operation and stored in a nitrogen canister. Informed consent was obtained from all participants, and the study was approved by the ethics committee on human research in Chongqing Medical University, Chongqing, China.

Immunohistochemical (IHC) assay

Tissue samples were collected after surgery and immediately frozen in liquid nitrogen. Prior to IHC assay, frozen sections were prepared with a cryostat (FACS caliber, Becton Dickinson, USA) at -20°C, dried at room temperature, and fixed with acetone. The PBMC were routinely isolated and the slides were prepared with a cytospinner. The ABC immunohistochemical assay was carried out according to the protocols we described before Anti-Livin (Antibody Diagnosis, USA) was prepared in our lab. The second antibody, a goat anti-mouse IgG labeled with biotin, was purchased from Vector Co., USA. Two hundred cells were counted and the intensity of staining for each of those cells was adjusted. Five grades were employed to express the degrees of staining, which represent 5 reaction coefficients respectively. The 5 products of every coefficient and the corresponding cell number were added up, which resulted in the value of a positive score. All slides were measured in duplicate. Those samples with a positive score over 10 or frequency over 5% were considered as positive.

Western blotting

Mouse tissues were dissected and homogenized in T-PER buffer in the presence of protease inhibitors. After homogenization, the lysates were centrifuged at 100 000 ×g, and the supernatants were saved for Western blot, Ciphergen (BioSource International, Inc., USA) Protein Chip Array. Equal amounts of lysates were subject to SDS-PAGE (Tris-glycine mini gel; 1:2500, BioSource International, Inc., USA) and Western blot analysis using antibodies specific for the following: Livin (1:2500, BioSource International, Inc., USA), VEGF (1:2500, BioSource International, Inc., USA), β-tublin (1:5000; BioSource International, Inc., USA). The optical densities of the specific bands were scanned and measured by image analysis software (HPIAS 2000, Tongji Qianping Company, Wuhan, China).

Reverse transcriptase-polymerase chain reaction (RT-PCR)

Animals were sacrificed at corresponding time points and total RNA in the treated sections were extracted according to the total RNA extracting kit. 4 μg total RNA was heated at 70°C for 5 min and then chilled on ice. Samples were incubated at 37°C for 1 h and the reaction was stopped by heating at 70°C for 10 min. Specific primers were designed for PCR: Livin and VEGF (Table 1). PCR was performed using 2 μL cDNA, 2 mmol/L dNTP, a specific pair of primers (20 pmol), 2 U DNA polymerase, 5 × PCR buffer and deionized water were added to the cDNA. The total volume was 25 μL. Amplification was performed for 32 cycles. The PCR products were separated by electrophoresis using a 1.5% (w/v) agarose gel containing 0.5 mg/L of ethidium bromide. Single band corresponding to the predicted size of the amplified product for Livin and VEGF and β-actin were identified under an ultraviolet transilluminator and transferred to a nylon filter membrane, and hybridized with an ECL-labeled probe 10 mL. The probes hybridized only to the bands which corresponded in size to the ethidium bromide stained gels, thereby confirming the amplified PCR products. The band densities were scanned with a densitometer. The relative amount of mRNA in each sample was calculated from the densitometry ratio of Livin and VEGF A value/β-actin A value.

Statistical analysis

Quantitative data were expressed as mean ± SD. All statistical analyses used the SPSS software for Windows 11.0 (SPSS, Inc., Chicago, IL, USA), using Student’s t-test for intergroup. For statistical evaluation one-way analysis of variance (ANOVA) were employed. Pearson correlation analysis was also performed to some index. P < 0.05 was considered as statistically significant.

RESULTS
Expression of Livin in esophageal carcinoma

The expression of Livin measured by IHC showed that expression of Livin in clinicopathologic stage two, three and four was significantly higher than that of stage one (P < 0.01). Optical density value and positive cell percentage in clinicopathologic stage two, three and four was significantly higher than that of stage one (P < 0.01). Furthermore, optical density value and positive cell percentage in clinicopathologic stage four was significantly higher than that of stage two and three (P < 0.01) (Figure 1A). The results by IHC showed that expression of Livin increases along with the progression of esophageal carcinoma. To further determine that Livin contributes to the pathogenesis of esophageal carcinoma, the expression of Livin was tested by Western blotting. In coincidence with IHC results, the expression of Livin by Western blotting showed that expression of Livin in clinicopathologic stage two, three and four was significantly higher than that of stage one (P < 0.01). Optical density value in clinicopathologic stage two, three and four was significantly higher than that of stage one (P < 0.01). Optical density value and positive cell percentage in clinicopathologic stage four was significantly higher than that of stage two and three (P < 0.01) (Figure 1B). Previously, the protein level of Livin increases the progression of esophageal carcinoma. To further evaluate that Livin contributes to the pathogenesis of esophageal carcinoma, the mRNA level of Livin was tested by RT-PCR. Up-regulation of Livin gene transcription matched with the protein level of Livin that was significantly increased along with the progression of esophageal carcinoma. Optical density value in clinicopathologic stage two, three and four was significantly higher than that of stage one (P < 0.01). Optical density value and positive cell percentage in clinicopathologic stage four was significantly higher than that of stage two and three (P < 0.01) (Figure 1C).

Expression of VEGF in esophageal carcinoma

The expression of VEGF measured by Western blotting and RT-PCR showed expression of VEGF increases along with the progression of esophageal carcinoma. The expression of VEGF by Western blotting showed that expression of VEGF in clinicopathologic stage two, three and four was significantly higher than that of stage one (P < 0.01). Optical density value in clinicopathologic stage two, three and four was significantly higher than that of stage one (P < 0.01). Optical density value and positive cell percentage in clinicopathologic stage four was significantly higher than that of stage two and three (P < 0.01) (Figure 2A). Previously, the protein level of VEGF increases the progression of esophageal carcinoma. To further evaluate that VEGF contributes to the pathogenesis of esophageal carcinoma, the mRNA level of VEGF was tested by RT-PCR. Up-regulation of VEGF gene transcription matched with the protein level of VEGF that was significantly increased along with the progression of esophageal carcinoma. Optical density value in clinicopathologic stage two, three and four was significantly higher than that of stage one (P < 0.01). Optical density value and positive cell percentage in clinicopathologic stage four was significantly higher than that of stage two and three (P < 0.01) (Figure 2B). Pearson correlation analysis showed that the level of VEGF by Western blotting has a positive correlation with Livin (r = 0.384, P < 0.05), and VEGF by RT-PCR a positive correlation with Livin (r = 0.452, P < 0.05) as well. The hypothesis has been made that Livin and VEGF play such an inter-enhancement role in the progress of esophageal carcinoma.

DISCUSSION

Livin may be essential for survival of certain cancer cells[11-13]. Of the IAP family members, CARD-RING domain of cIAP1, CARD-RING domain of cIAP2, X-linked IAP, and NAIP are expressed in normal adult tissues[14,15], whereas Survivin expression is limited to tumor tissues[16-18]. It has been reported that Livin was expressed in some tumor cells and several fetal tissues but not in normal adult tissues. Hence, its expression profiles seem to be very similar to those of Survivin, a cancer-specific IAP family protein. In the present study, we investigated expression of Livin in human esophageal carcinoma and analyze its relationship with clinical stages. The results showed that Livin positivity was also significantly correlated with tumor stages, increasing with tumor progression. Expression of Livin increased with the process of esophageal carcinoma. In the fourth clinical stage, expression of Livin was the most significant. Therefore, over-expression of Livin contributes to the pathogenesis of esophageal carcinoma. Livin is known to play an important role in antiapoptotic cell survival by suppression of caspase family proteins. The other antiapoptotic proteins, including IAP family and Bcl-2 family[19,20], were also reported to be overexpressed in esophageal carcinoma cells. Namely, Survivin, a member of the IAP family, was overexpressed in esophageal carcinoma specimens, and patients with Survivin expression had significant unfavorable prognosis. Survivin was one of the tumor-associated antigens recognized by both humoral and cellular immunity of cancer patients, and could become a target of CTL. It has been reported that Livin might be involved in the progression of superficial bladder cancer and used as a marker of early recurrence[19,21,22]. Because loss of Livin expression could lead to apoptotic cell death in cervical cancer cells, suppression of Livin should have much advantage in cancer treatment. From this perspective, Livin might be a good candidate as a molecular target for treatment as well as having a prognostic value for esophageal carcinoma.

VEGF plays a crucial role in tumour expansion by initiating permeabilization of blood vessels, by extravasation of plasma proteins, by invasion of stromal cells, and by causing the sprouting of new blood vessels that supply the tumour with oxygen and nutrients. A number of studies have shown that expression of certain VEGF transcripts are correlated with tumour progression[23,24]. Although increases of certain VEGF transcripts have been demonstrated to correlate with the progression of various tumours[25-27], the actual protein levels of the different VEGF isoforms and their significance during cellular transformation are unknown. Moreover, it has been suggested that elevated protein expression in tumour tissues was mediated by both enhanced transcription and translation. Thus, in order to understand the role of VEGF in tumour progression, it is important to investigate VEGF expression of different clinical stages at the protein and mRNA level during tumourigenesis. In the present study, we investigated expression of VEGF in human esophageal carcinoma and analyze its relationship with clinical stages. The results showed that VEGF positivity was also significantly correlated with tumor stages, increasing with tumor progression. Expression of VEGF increased with the process of esophageal carcinoma. In the fourth clinical stage, expression of VEGF was the most significant. Because previous evidence indicated that VEGF plays a crucial role in tumour expansion by initiating permeabilization of blood vessels, our results suggest that over-expression of VEGF contributes to the pathogenesis of esophageal carcinoma. Allowing that VEGF introduces the sprouting of new blood vessels that supply the tumour with oxygen and nutrients, it is a novel strategy for treating esophageal carcinoma, and the results of the ongoing clinical trials in patients with esophageal carcinoma are eagerly awaited. Although encouraging data have emerged to support the use of antiangiogenic therapy in some cancers such as myeloma and glioma, poor tumor response has been reported in others[28-31]. One major problem confronting clinical trials of antiangiogenic therapy is the lack of an established surrogate marker to measure antiangiogenic activity in vivo in cancer patients. Tumor response in terms of shrinkage alone might not be an appropriate index of treatment efficacy because of the cytostatic nature of the treatment. Instead, the ability of an antiangiogenic drug to induce prolonged stabilization of the disease and increase survival might be more meaningful end points for clinical trials on antiangiogenic therapy.

Taken together, over-expression of Livin and VEGF contributes to the pathogenesis of esophageal carcinoma. The level of VEGF has a positive correlation with Livin. The hypothesis has been made that Livin and VEGF played such an inter-enhancement role in the progress of esophageal carcinoma. Inhibitors of Livin and VEGF may be potential targets for the prevention or treatment of human esophageal carcinoma.

COMMENTS
Background

Livin expression may be essential for survival of certain cancer cells. Vascular endothelial growth factor (VEGF) is a potent mitogen for endothelial cells, and its expression has been correlated with increased tumour angiogenesis. It is important to investigate Livin and VEGF expression of different clinical stages at the protein and mRNA level during tumourigenesis.

Research frontiers

In order to further explore the role of Livin and VEGF in the development of esophageal carcinoma, it is critical to investigate the role of Livin and VEGF in human esophageal carcinoma and analyze its relationship with clinical stages.

Innovations and breakthroughs

Over-expression of Livin and VEGF contributes to the pathogenesis of esophageal carcinoma. The level of VEGF has a positive correlation with Livin. The hypothesis has been made that Livin and VEGF have an inter-enhancement role in the progress of esophageal carcinoma.

Applications

Inhibitors of Livin and VEGF may be potential targets for the prevention or treatment of human esophageal carcinoma.

Terminology

Livin may be essential for survival of certain cancer cells. Of the IAP family members, Livin interacts with downstream caspases, such as caspase-3, caspase-7, and caspase-9, leading to their inactivation and degradation. Its overexpression can protect cells from several proapoptotic stimuli. Very importantly, treatment of cancer cells with Livin antisense oligo DNA causes apoptotic cell death, indicating that Livin expression may be essential for survival of certain cancer cells. VEGF is a potent mitogen for endothelial cells, and its expression has been correlated with increased tumour angiogenesis.

Peer review

This is an interesting report showing increased expression of Livin and VEGF in late stages (II III IV) of esophageal carcinoma compared to early stage (I) of esophageal carcinoma. Since Livin expression may affect apoptosis, correlation of Livin with assays of apoptosis will be of interest. In addition, correlation of Livin expression with patient survival in various stages of esophageal carcinoma will also be interesting.

References
1.  Li JH, He WJ, He YJ. [Expression and clinical significance of Survivin and Livin in DukesoB colorectal cancer]. Ai Zheng. 2007;26:547-551.  [PubMed]  [DOI]
2.  Hariu H, Hirohashi Y, Torigoe T, Asanuma H, Hariu M, Tamura Y, Aketa K, Nabeta C, Nakanishi K, Kamiguchi K. Aberrant expression and potency as a cancer immunotherapy target of inhibitor of apoptosis protein family, Livin/ML-IAP in lung cancer. Clin Cancer Res. 2005;11:1000-1009.  [PubMed]  [DOI]
3.  Kasof GM, Gomes BC. Livin, a novel inhibitor of apoptosis protein family member. J Biol Chem. 2001;276:3238-3246.  [PubMed]  [DOI]
4.  Nachmias B, Ashhab Y, Bucholtz V, Drize O, Kadouri L, Lotem M, Peretz T, Mandelboim O, Ben-Yehuda D. Caspase-mediated cleavage converts Livin from an antiapoptotic to a proapoptotic factor: implications for drug-resistant melanoma. Cancer Res. 2003;63:6340-6349.  [PubMed]  [DOI]
5.  Chang H, Schimmer AD. Livin/melanoma inhibitor of apoptosis protein as a potential therapeutic target for the treatment of malignancy. Mol Cancer Ther. 2007;6:24-30.  [PubMed]  [DOI]
6.  Liu B, Han M, Wen JK, Wang L. Livin/ML-IAP as a new target for cancer treatment. Cancer Lett. 2007;250:168-176.  [PubMed]  [DOI]
7.  Kim DK, Alvarado CS, Abramowsky CR, Gu L, Zhou M, Soe MM, Sullivan K, George B, Schemankewitz E, Findley HW. Expression of inhibitor-of-apoptosis protein (IAP) livin by neuroblastoma cells: correlation with prognostic factors and outcome. Pediatr Dev Pathol. 2005;8:621-629.  [PubMed]  [DOI]
8.  Kamat AA, Merritt WM, Coffey D, Lin YG, Patel PR, Broaddus R, Nugent E, Han LY, Landen CN Jr, Spannuth WA. Clinical and biological significance of vascular endothelial growth factor in endometrial cancer. Clin Cancer Res. 2007;13:7487-7495.  [PubMed]  [DOI]
9.  Hervé MA, Buteau-Lozano H, Vassy R, Bieche I, Velasco G, Pla M, Perret G, Mourah S, Perrot-Applanat M. Overexpression of vascular endothelial growth factor 189 in breast cancer cells leads to delayed tumor uptake with dilated intratumoral vessels. Am J Pathol. 2008;172:167-178.  [PubMed]  [DOI]
10.  Zhang B, Zhao WH, Zhou WY, Yu WS, Yu JM, Li S. Expression of vascular endothelial growth factors-C and -D correlate with evidence of lymphangiogenesis and angiogenesis in pancreatic adenocarcinoma. Cancer Detect Prev. 2007;31:436-442.  [PubMed]  [DOI]
11.  Yagihashi A, Ohmura T, Asanuma K, Kobayashi D, Tsuji N, Torigoe T, Sato N, Hirata K, Watanabe N. Detection of autoantibodies to survivin and livin in sera from patients with breast cancer. Clin Chim Acta. 2005;362:125-130.  [PubMed]  [DOI]
12.  Wagener N, Crnkovic-Mertens I, Vetter C, Macher-Goppinger S, Bedke J, Grone EF, Zentgraf H, Pritsch M, Hoppe-Seyler K, Buse S. Expression of inhibitor of apoptosis protein Livin in renal cell carcinoma and non-tumorous adult kidney. Br J Cancer. 2007;97:1271-1276.  [PubMed]  [DOI]
13.  Choi J, Hwang YK, Sung KW, Lee SH, Yoo KH, Jung HL, Koo HH, Kim HJ, Kang HJ, Shin HY. Expression of Livin, an antiapoptotic protein, is an independent favorable prognostic factor in childhood acute lymphoblastic leukemia. Blood. 2007;109:471-477.  [PubMed]  [DOI]
14.  Ashhab Y, Alian A, Polliack A, Panet A, Ben Yehuda D. Two splicing variants of a new inhibitor of apoptosis gene with different biological properties and tissue distribution pattern. FEBS Lett. 2001;495:56-60.  [PubMed]  [DOI]
15.  Takeuchi H, Kim J, Fujimoto A, Umetani N, Mori T, Bilchik A, Turner R, Tran A, Kuo C, Hoon DS. X-Linked inhibitor of apoptosis protein expression level in colorectal cancer is regulated by hepatocyte growth factor/C-met pathway via Akt signaling. Clin Cancer Res. 2005;11:7621-7628.  [PubMed]  [DOI]
16.  Kleinberg L, Lie AK, Fløenes VA, Nesland JM, Davidson B. Expression of inhibitor-of-apoptosis protein family members in malignant mesothelioma. Hum Pathol. 2007;38:986-994.  [PubMed]  [DOI]
17.  Kleinberg L, Fløenes VA, Nesland JM, Davidson B. Survivin, a member of the inhibitors of apoptosis family, is down-regulated in breast carcinoma effusions. Am J Clin Pathol. 2007;128:389-397.  [PubMed]  [DOI]
18.  Yin W, Chen N, Zhang Y, Zeng H, Chen X, He Y, Wang X, Zhou Q. Survivin nuclear labeling index: a superior biomarker in superficial urothelial carcinoma of human urinary bladder. Mod Pathol. 2006;19:1487-1497.  [PubMed]  [DOI]
19.  Gazzaniga P, Gradilone A, Giuliani L, Gandini O, Silvestri I, Nofroni I, Saccani G, Frati L, Aglianò AM. Expression and prognostic significance of LIVIN, SURVIVIN and other apoptosis-related genes in the progression of superficial bladder cancer. Ann Oncol. 2003;14:85-90.  [PubMed]  [DOI]
20.  Nedelcu T, Kubista B, Koller A, Sulzbacher I, Mosberger I, Arrich F, Trieb K, Kotz R, Toma CD. Livin and Bcl-2 expression in high-grade osteosarcoma. J Cancer Res Clin Oncol. 2008;134:237-244.  [PubMed]  [DOI]
21.  Liu HB, Kong CZ, Zeng Y, Liu XK, Bi JB, Jiang YJ, Han S. Livin may serve as a marker for prognosis of bladder cancer relapse and a target of bladder cancer treatment. Urol Oncol. 2009;27:277-283.  [PubMed]  [DOI]
22.  Zhu Z, Wang Y, Ding X, Zeng F, Xu K. Expression and prognostic significance of Livin in the progression of bladder cancer. J Huazhong Univ Sci Technolog Med Sci. 2008;28:90-92.  [PubMed]  [DOI]
23.  Eichhorn ME, Kleespies A, Angele MK, Jauch KW, Bruns . Angiogenesis in cancer: molecular mechanisms, clinical impact. Langenbecks Arch Surg. 2007;392:371-379.  [PubMed]  [DOI]
24.  Zhang J, Jia Z, Li Q, Wang L, Rashid A, Zhu Z, Evans DB, Vauthey JN, Xie K, Yao JC. Elevated expression of vascular endothelial growth factor correlates with increased angiogenesis and decreased progression-free survival among patients with low-grade neuroendocrine tumors. Cancer. 2007;109:1478-1486.  [PubMed]  [DOI]
25.  Das K, Zhao Y, Sugiono M, Lau W, Tan P, Cheng C. Differential expression of vascular endothelial growth factor165b in transitional cell carcinoma of the bladder. Urol Oncol. 2007;25:317-321.  [PubMed]  [DOI]
26.  Raspollini MR, Asirelli G, Taddei GL. The role of angiogenesis and COX-2 expression in the evolution of vulvar lichen sclerosus to squamous cell carcinoma of the vulva. Gynecol Oncol. 2007;106:567-571.  [PubMed]  [DOI]
27.  Baritaki S, Sifakis S, Huerta-Yepez S, Neonakis IK, Soufla G, Bonavida B, Spandidos DA. Overexpression of VEGF and TGF-beta1 mRNA in Pap smears correlates with progression of cervical intraepithelial neoplasia to cancer: implication of YY1 in cervical tumorigenesis and HPV infection. Int J Oncol. 2007;31:69-79.  [PubMed]  [DOI]
28.  Pouessel D, Culine S, Verhoest G, Patard JJ. [Renal cell carcinoma and antiangiogenic therapies]. Presse Med. 2008;37:628-633.  [PubMed]  [DOI]
29.  Pouessel D, Culine S. [Angiogenesis targeting in renal carcinomas]. Bull Cancer. 2007;94:F223-F226.  [PubMed]  [DOI]
30.  Yilmaz A, Ernam D, Unsal E, Demirag F, Atikcan S, Taştepe I. Vascular endothelial growth factor immunostaining correlates with postoperative relapse and survival in non-small cell lung cancer. Arch Med Res. 2007;38:764-768.  [PubMed]  [DOI]
31.  Giaccone G. The potential of antiangiogenic therapy in non-small cell lung cancer. Clin Cancer Res. 2007;13:1961-1970.  [PubMed]  [DOI]
Footnotes

Peer reviewer: Kam-Meng Tchou-Wong, Assistant Professor, Departments of Environmental Medicine and Medicine, NYU School of Medicine, 57 Old Forge Road, Tuxedo, New York 10987, United States

S- Editor Li DL L- Editor Alpini GD E- Editor Yin DH

Write to the Help Desk