BPG is committed to discovery and dissemination of knowledge
Helicobacter Pylori Open Access
©2007 Baishideng Publishing Group Co., Limited. All rights reserved.
World J Gastroenterol. Feb 14, 2007; 13(6): 845-850
Published online Feb 14, 2007. doi: 10.3748/wjg.v13.i6.845
Adherence and invasion of mouse-adapted H pylori in different epithelial cell lines
Mao-Jun Zhang, Fan-Liang Meng, Xiao-Yun Ji, Li-Hua He, Jian-Zhong Zhang, Department of Diagnostics, National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing 102206, China
Author contributions: All authors contributed equally to the work.
Supported by the National Natural Science Foundation of China, No. 30370078
Correspondence to: Dr. Jian-Zhong Zhang, Department of Diagnostics, National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention, PO Box 5, Changping, Beijing 102206, China. helico99@sina.com
Telephone: +86-10-61739456 Fax: +86-10-61730233
Received: January 14, 2007
Revised: January 28, 2007
Accepted: February 9, 2007
Published online: February 14, 2007

Abstract

AIM: To assess the adhesion and invasion abilities of different mouse adapted H pylori strains in different cell lines in vitro and investigate their effects on the virulence factors cagA and vacA.

METHODS: The adherence and invasion abilities of different H pylori strains in different epithelial cell lines were examined by the gentamycin protection assay. The null mutants of cagA and vacA were processed by direct PCR mutation method. The morphologic changes of different cell lines after H pylori attachment were examined by microscopy.

RESULTS: The densities of adherence to and invasion into cells in vitro were different from those in the mouse infection experiments. 88-3887 strain could invade and adhere to cells stronger than SS1 and X47. All tested strains had better adhering and invasive abilities in SCG-7901 cell. CagA and vacA minus mutants had the same invasion and adherent abilities as their wild types. In all strains and cell lines tested, only AGS cell had the significant hummingbird phenotype after inoculation with the 88-3887 wild-type.

CONCLUSION: Both the host cells and the bacteria play important parts in the invasion and adhesion abilities of H pylori. CagA and VacA are not related to the ability of invasion and adhesion of H pylori in different cell lines in vitro.

Key Words: H pylori; Adherence; Invasion; Cell line



INTRODUCTION

Infection with the human gastric pathogen H pylori can develop into chronic gastritis, peptic ulcer and gastric cancer[1-4]. Adhesion to the gastric epithelium and the host responses take the crucial role in the pathogenesis of H pylori infections.

Adherence is considered to be associated with both colonization and virulence properties of H pylori. A mouse infection model has been used to investigate the pathogenesis of H pylori[5-8]. Results from Dr. Berg. DE and colleagues suggested that different H pylori strains had gradient colonization abilities in various mouse cell lines in vivo (unpublished data). Studies at cellular levels showed H pylori induced the secretion of pro-inflammatory cytokines, cell proliferation, and apoptosis of epithelial cells and the cell lines were used as models for the investigation of the interaction between the bacteria and hosts in vitro[9-12]. There were proofs that H pylori were not present in the gastric epithelial cells but in the mucus layer overlying the gastric tissue[1,13]. However, there were also a number of biopsy studies[14-16] and cell culture infection models[17-21] that provided increasing evidence for the intracellular survival of H pylori. Internalization into the host cell should be considered a major strategy to evade the host immune response of the bacteria. Amieva et al[22] proved that the intercellular H pylori may be released to repopulate the extracellular environment again. It is well accepted that H pylori infection is hard to be eradicated in some cases, and triple drug therapy often fails to eliminate H pylori in infected patients[23-25].

In this study, the adherence and invasion abilities of 3 mouse-adapted H pylori strains, which colonized the mice at different densities in different epithelial cells lines, were assessed by gentamycin adherence and invasiveness assay. Moreover, to investigate whether the virulence factors cagA and vacA could affect these abilities, mutants in these genes were established to examine their capacities to adhere to epithelial cells and compared to their wild-type counterparts.

MATERIALS AND METHODS
Bacteria and culture condition

The backgrounds of 3 mouse passed H pylori strains are shown in Table 1. All these mouse passed strains were kindly offered by Dr. Berg DE, (Washington University, School of Medicine, St. Louis, MO 63 110). The mouse inoculation experiments were done with C57BL/6J IL-12 KO mouse by Dr Berg DE’s lab and the results from all these 4 strains were obtained. 88-3887 is a mouse adapted strain parentally from H pylori 26695. So far, there has been no reported data on the mouse colonization capacity of 88-3887 cagA::cam and SS1 vacA::cam.

Table 1 Background of mouse passed H pylori strains.
H pylori strainsCagATissue tropismCFU/g of mouse stomach tissue
SS1+Antrum106
X47-Corpus106
88-3887+1None104

Wild type H pylori strains of SS1, X47 and 88-3887 were grown in an H pylori selective medium (Columbia Agar Base supplemented with 5% sheep blood and 0.25 mg/mL vancomycin, 0.2 mg/mL amphotericin B, 0.2 mg/mL polymyxin B and 0.3 mg/mL trimethoprim) and incubated at 37°C in a microaerobic atmosphere containing 5% O2, 10% CO2 and 85% N2. CagA and vacA null mutants (88-3887 cagA::cam, SS1 vacA::cam) were grown in an H pylori selective medium with 20 μg/mL chloramphenicol and cultured under the same condition as wild type strains.

Generation of H pylori allelic replacement mutants

The null mutants for cagA::cam and vacA::cam were generated by direct PCR method as described previously[26,27]. Chloramphenicol resistance cassette (cat) was amplified using primers C1 and C2 designated from the pBlueScript II SK plasmid. The alleles in which cagA and vacA were replaced by cat were generated by the PCR method. The PCR products containing those ΔcagA (cagA::cam) and ΔvacA (vacA::cam) alleles were used to transform the wild-type H pylori strains 88-3887 and SS1 with selection for Camr (20 μg/mL). The primers for 88-3887 ΔcagA (88-3887 ΔcagA::cam ) were cagA-P1, cagA-P2, cagA-P3 and cagA-P4. Primers for SS1 ΔvacA (SS1 ΔvacA::cam) mutant were vacA-P1, vacA-P2, vacA-P3 and vacA-P4. The sequences of the primers are listed in Table 2. All mutations were confirmed by specific PCR using cat, vacA and cagA genes.

Table 2 Primers for null mutant of cagA and vacA of H pylori.
PrimerSequence (5’-3’)
C1GATATAGATTGAAAAGTGGAT
C2TTATCAGTGCGACAAACTGGG
CagA-P1CCCAAGCTGATCAGAGTGAG
CagA-P2ATCCACTTTTCAATCTATATCGGCTTCGTTAGTCATTG TTTCTCC
CagA-P3CCCAGTTTGTCGCACTGATAAGGTGGTTTCCAAAAAT CTTAAAGGATT
CagA-P4GGTTGCACGCATTTTCCCTTAATC
VacA-P1CTACGGTGTATGATGACGCTCA
VacA-P2ATCCACTTTTCAATCTATATCCACAAAGGGTGCGAC TTTAGAC
VacA-P3CCCAGTTTGTCGCACTGATAAGATCAATCAAGCTTG AATTTCA
VacA-P4TTAGAAACTATACCTCATTCCTAAA
Preparation of cell line cultures

AGS cells (ATCC CRL 1739, human gastric adenocarcinoma epithelial cell line), SGC-7901 cells (human gastric cancer cell line from laboratory collection), MDCK cells (ATCC CCL-34, Marbin-Darby canine kidney epithelial cell line) were seeded to generate 2 × 105 cells in RPMI 1640 medium supplemented with 10% FCS (Gibco BRL, Eggenstein, Germany) per well in 24-well tissue culture plates. The plates were incubated at 37°C in 5% CO2 for 24 h. The culture medium was replaced with fresh RPMI1640 medium without FCS for 2 h before the inoculation of bacteria.

Adherence and invasiveness assay

The 24 h cultured bacteria were harvested from plates with phosphate-buffered saline (PBS) and washed by centrifugation at 5000 r/min for 5 min at 4°C 3 times. The pellets were suspended in PBS to 1 OD600 (approximately 108 CFU/mL), and 0.1 mL of this suspension was inoculated into each duplicate host cell wells to achieve a multiplicity of infection (MOI) of 100. As a control, 0.1 mL of PBS was added to each host cell lines. Infection was carried out at 37°C in 5% CO2 for 5 h. After 5 h infection, the monolayer was then washed 3 times with 1 mL RPMI1640 with 10% FCS medium and reincubated under the same conditions for another 2 h. Cell culture medium containing 25 mg/mL of gentamicin was added to each of the wells for the enumeration of intracellular bacteria (In preliminary experiments, 25 mg/mL of gentamicin could kill all H pylori isolates after a 2 h exposure and 0.1% saponin had no influence on H pylori culture compared with PBS). Following incubation, all monolayers (with or without gentamicin) were washed 5 times with RPMI 1640 and lysed with 0.1% saponin (Sigma cat#S-7900) in PBS. The suspensions were serial diluted. Both the intracellular bacteria and the total cell-associated bacteria were estimated by counting the number of CFU on H pylori selective plates. Results are expressed as the average from 3 independent experiments. Wild type H pylori strains and their mutants were inoculated into different cell lines respectively and mixed simultaneously. For the mix infection, the bacteria were counted on the normal selective medium and the selective medium with 20 μg/mL chloramphenicol separately.

Image capture

After the co-culture of bacteria and different cells for 5 h, the monolayer cells were washed by PBS and the images were obtained under the microscope (Olympus BX 51).

RESULTS
Invasion and adherence abilities of H pylori strains in different cell lines

SS1, X47 strains had higher capacities to colonize the mice than 88-3887 but the intensities of their invasion and adherence in the cell lines were quite different. 88-3887 could invade and adhere to the cells better than SS1 and X47. The intensity of SS1 was lowest among the three tested strains. Each of the three H pylori strains had the highest adherent and invasive ability in the SCG-7901 cell. 88-3887 ΔcagA::cam and SS1 ΔvacA::cam had the same invasiveness and adherence ability as their wild type counterparts, respectively. The effects of different bacteria in different cell lines are shown in Figure 1.

Figure 1
Figure 1 Levels of adherence and invasion of H pylori in different cell lines. Bacteria were added to AGS cell monolayer at an MOI of 100 for 5 h at 37°C in a humidified atmosphere with 5% CO2. Data were obtained by adherence and invasiveness assays in three independent experiments and are expressed as CFU per well of AGS cells. The left side 3 refrangible lines indicate the ability of the adherence in 3 different cell lines. The right sides indicate the invasiveness ability in the 3 cell lines. Values represent the mean CFU of viable bacteria recovered per well of a 24-well tissue culture tray.
Morphologic changes of different cell lines after inoculation with H pylori

Cell morphology was examined under the microscope after 5 h co-culture. Fifty percent AGS cells became elongated like the hummingbird phenotype after attachment with 88-3887 wild type strain, while there were no such hummingbird like changes in AGS cell after inoculation with 88-3887 ΔcagA::cam. There were no significant hummingbird like phenotype in AGS after attachment with X47, SS1 and SS1vacA::cam strains. MDCK cells were scattered and slightly elongated after inoculation with 88-3887, 88-3887 ΔcagA::cam, SS1 and SS1 ΔvacA::cam strains. After inoculation with X47 wild type strains, MDCK cells changed to round shape. The attachment of the 5 tested H pylori strains caused the SCG-7901 cells to become scattered, and there was no significant difference in phenotypic changes between different strains. The morphologic images are shown in Figure 2.

Figure 2
Figure 2 Images showing morphologic changes induced by H pylori attachment. After co-culture of the bacteria with different cells for 5 h, the monolayer AGS cells were washed with PBS and the images were captured by microscopic Olympus BX51. A: AGS cell; B: The hummingbird/scattering appearance of AGS after being attached with 88-3887 wild-type, 5 h; C: AGS with H pylori 88-3887 cagA minus mutant (88-3887 cagA::cam), 5 h.
DISCUSSION

H pylori is one of the most prevalent and persistent infectious agents in humans[28-30]. Adhesion is considered to be a major process for H pylori to colonize the host tissue and cause diseases. Intimate attachment to the host cells could facilitate the bacterium’s colonization, efficient delivery of effecter proteins such as cagA and vacA from the bacteria to the host cell and gain of nutrients from the environment. Bacteria with better adherence properties would colonize the host at higher densities and cause severe damage of the host[31,32]. Although H pylori have generally been considered as an extracellular pathogen, a number of in vitro infection experiments and biopsy examinations have shown that it is capable of occasionally entering mammalian cells[33]. This penetration action may be one of the mechanisms for survival of the bacteria. In the present study, all tested H pylori strains adhered to SCG-7901, AGS and MDCK cells in a gradient way and the densities were 107-8, 103-5 and 102-4 CFU/mL, respectively. The intensities of the adhering ability in different cells in vitro were quite different from those in the mouse infection models in vivo and the H pylori adherence capacities in human cells were stronger than that in the canine kidney epithelial cells. According to this study, the invasive capacity was always consistent with the adhesion ability in all the tested cell lines, the higher the adhesion capacity, the better the invasion ability. Our results are consistent with previous evidence of the invasion ability in mammalian cells of H pylori[22,34] and it may imply the varied attachment mechanisms among different host species during H pylori infection. It also supports the view that both the host and bacterial factors mediate the adhesion and invasion of H pylori.

In the present study, the gentamicin protection assay was relatively simple, reproducible and measureable. Bacteria were determined after recovery from an additional 2 h incubation with gentamicin in the medium. The internalized bacteria were protected since the gentamicin could not penetrate the mammalian cell membranes. All the calculated data were repeated 3 times and each host cell had duplicate wells for each H pylori strain for validation.

CagA is present in some H pylori strains with enhanced virulence, and has been identified as an important risk factor for development of severe gastric diseases. H pylori strains are divided into two groups named type I and type II strains, based on whether they express cagA or not[35,36]. It was previously described that cagA was an effector protein of H pylori that was translocated via a type IV secretion system into gastric epithelial cells, interacted with different components in the host cell signal transduction pathways and the actin binding proteins, which ultimately affect the cytoskeletal organization[37-40]. This study showes no correlation between the presence of cagA with the ability of adhesion and invasion of H pylori. The only hummingbird response of AGS cell was induced by 88-3887 wild type strain but not the cagA minus mutant. This result is consistent with the previous conclusion that cagA plays a crucial role in the host cytoskeleton change. However, neither SS1 (cagA+) nor X47 (cagA-) could induce the same morphologic changes in the tested cells. Apart from AGS with the 88-3887 wild type, the other tested host cells attached with H pylori presented the under stress phenotypic changes such as cell scattering, elongation, and roundness in shape. These induced changes were not necessarily associated with cagA or vacA. It has been discovered that translocated cagA forms a physical complex with tyrosine phosphatase SHP-2, which plays an important role in the signal transduction pathway of the cell skeleton. According to the sequences constituting the SHP-2 binding site, cagA proteins can be sub-classified into East Asian and Western types, which have different binding and transforming activities[41,42]; while SS1 and 88-3887 all belong to the Western type. However, this could not explain why SS1 did not induce the same phenotypic change in AGS as 88-3887. SS1 also harbors cagA and could achieve high level mouse colonization. But this is controversial to the fact that the cag PAI in this strain is incomplete, as it lacks one open reading frame in the so-called ‘left half’ of the island[43,44]. On the other hand, we had no evidence to support that the gene defect SS1 strain caused different effects on AGS phenotypic changes from that of 88-3887 strain. Dana et al[45] reported that mouse adapted strains had a reduced capacity to induce inflammatory responses in AGS cells and suggests that such bacteria are more easily to colonize mice. The present results may indicate that the effector function of cagA in the host cell cytoskeletal rearrangement is pivotal and bacterium and host dependent. In different hosts, different H pylori strains invade via alternate receptor mechanisms, and various signal transduction pathways. The high degree genetic diversities of H pylori may be generated depending on the geographic origin or the ethnic origin of the host.

VacA cytotoxin is also considered to be an important virulence factor in H pylori, since it induces large cytoplasmic vacuoles in cultured mammalian cells. VacA is present in all H pylori strains and has been shown to be related to the colonization and intracellular survival of the bacteria[46,47]. This study shows that vacA has no effect on the adhesion and invasion abilities of H pylori. Our results are conflict with Terebiznik’s data but consistent with Amieva et al[22]'s observation that the internalization of H pylori did not require vacA or cagA[48]. The phenotypic changes of the host cells attached with SS1 vacA minus mutant were the same as the wild type H pylori strains.

In summary, this study assesses the adherence and invasiveness abilities of different mouse adapted H pylori strains in different mammalian cell lines. The results imply that both the host-genetic and the microbial factors are involved in the development of the pathogenic infection outcome. VacA and cagA constitute important virulence factors of H pylori and both are delivered into the host cells depending on the intimate contact between bacteria and the gastric epithelial cells. This study suggests that neither vacA nor cagA is associated with the adhesion and invasion abilities of H pylori in different mammalian cell models. The phenotypic changes induced by H pylori are also host and bacterium dependent.

ACKNOWLEDGMENTS

We are grateful to Dr. Douglas E Berg for his kind donation of the pBlueScript II SK plasmid and the entire mouse adapted H pylori strains.

References
1.  Marshall BJ, Warren JR. Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet. 1984;1:1311-1315.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3779]  [Cited by in RCA: 3250]  [Article Influence: 77.4]  [Reference Citation Analysis (11)]
2.  Graham DY, Lew GM, Evans DG, Evans DJ, Klein PD. Effect of triple therapy (antibiotics plus bismuth) on duodenal ulcer healing. A randomized controlled trial. Ann Intern Med. 1991;115:266-269.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 163]  [Cited by in RCA: 134]  [Article Influence: 3.8]  [Reference Citation Analysis (0)]
3.  Parsonnet J, Hansen S, Rodriguez L, Gelb AB, Warnke RA, Jellum E, Orentreich N, Vogelman JH, Friedman GD. Helicobacter pylori infection and gastric lymphoma. N Engl J Med. 1994;330:1267-1271.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1376]  [Cited by in RCA: 1204]  [Article Influence: 37.6]  [Reference Citation Analysis (0)]
4.  Williams MP, Pounder RE. Helicobacter pylori: from the benign to the malignant. Am J Gastroenterol. 1999;94:S11-S16.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 47]  [Cited by in RCA: 48]  [Article Influence: 1.8]  [Reference Citation Analysis (0)]
5.  Taylor JM, Ziman ME, Huff JL, Moroski NM, Vajdy M, Solnick JV. Helicobacter pylori lipopolysaccharide promotes a Th1 type immune response in immunized mice. Vaccine. 2006;24:4987-4994.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 25]  [Cited by in RCA: 32]  [Article Influence: 1.6]  [Reference Citation Analysis (0)]
6.  Tan S, Fraley CD, Zhang M, Dailidiene D, Kornberg A, Berg DE. Diverse phenotypes resulting from polyphosphate kinase gene (ppk1) inactivation in different strains of Helicobacter pylori. J Bacteriol. 2005;187:7687-7695.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 33]  [Cited by in RCA: 36]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
7.  Suto H, Zhang M, Berg DE. Age-dependent changes in susceptibility of suckling mice to individual strains of Helicobacter pylori. Infect Immun. 2005;73:1232-1234.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 8]  [Article Influence: 0.4]  [Reference Citation Analysis (0)]
8.  Akada JK, Ogura K, Dailidiene D, Dailide G, Cheverud JM, Berg DE. Helicobacter pylori tissue tropism: mouse-colonizing strains can target different gastric niches. Microbiology. 2003;149:1901-1909.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 54]  [Cited by in RCA: 54]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
9.  Crabtree JE, Farmery SM, Lindley IJ, Figura N, Peichl P, Tompkins DS. CagA/cytotoxic strains of Helicobacter pylori and interleukin-8 in gastric epithelial cell lines. J Clin Pathol. 1994;47:945-950.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 247]  [Cited by in RCA: 221]  [Article Influence: 6.9]  [Reference Citation Analysis (0)]
10.  Day AS, Su B, Ceponis PJ, Jones NL, Yau E, Sieveking D, Sherman PM. Helicobacter pylori infection induces interleukin-18 production in gastric epithelial (AGS) cells. Dig Dis Sci. 2004;49:1830-1835.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 13]  [Article Influence: 0.6]  [Reference Citation Analysis (0)]
11.  Ledig S, Wagner S, Manns MP, Beil W, Athmann C. Role of the receptor-mediated apoptosis in Helicobacter pylori in gastric epithelial cells. Digestion. 2004;70:178-186.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 12]  [Article Influence: 0.6]  [Reference Citation Analysis (0)]
12.  Karabay G, Nacar A, Can F, Demirbilek M, Bacanli D, Take G, Yazici AC. Apoptosis and proliferation in gastric epithelium due to Helicobacter pylori: an immunohistochemical and ultrastructural study. Acta Gastroenterol Belg. 2006;69:191-196.  [PubMed]  [DOI]
13.  Molyneux AJ, Harris MD. Helicobacter pylori in gastric biopsies--should you trust the pathology report? J R Coll Physicians Lond. 1993;27:119-120.  [PubMed]  [DOI]
14.  el-Shoura SM. Helicobacter pylori: I. Ultrastructural sequences of adherence, attachment, and penetration into the gastric mucosa. Ultrastruct Pathol. 1995;19:323-333.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 29]  [Cited by in RCA: 27]  [Article Influence: 0.9]  [Reference Citation Analysis (0)]
15.  Engstrand L, Graham D, Scheynius A, Genta RM, El-Zaatari F. Is the sanctuary where Helicobacter pylori avoids antibacterial treatment intracellular? Am J Clin Pathol. 1997;108:504-509.  [PubMed]  [DOI]
16.  Noach LA, Rolf TM, Tytgat GN. Electron microscopic study of association between Helicobacter pylori and gastric and duodenal mucosa. J Clin Pathol. 1994;47:699-704.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 110]  [Cited by in RCA: 101]  [Article Influence: 3.2]  [Reference Citation Analysis (0)]
17.  Bukholm G, Tannaes T, Nedenskov P, Esbensen Y, Grav HJ, Hovig T, Ariansen S, Guldvog I. Colony variation of Helicobacter pylori: pathogenic potential is correlated to cell wall lipid composition. Scand J Gastroenterol. 1997;32:445-454.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 46]  [Cited by in RCA: 48]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
18.  Evans DG, Evans DJ, Graham DY. Adherence and internalization of Helicobacter pylori by HEp-2 cells. Gastroenterology. 1992;102:1557-1567.  [PubMed]  [DOI]
19.  Petersen AM, Blom J, Andersen LP, Krogfelt KA. Role of strain type, AGS cells and fetal calf serum in Helicobacter pylori adhesion and invasion assays. FEMS Immunol Med Microbiol. 2000;29:59-67.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 17]  [Cited by in RCA: 19]  [Article Influence: 0.7]  [Reference Citation Analysis (0)]
20.  Segal ED, Falkow S, Tompkins LS. Helicobacter pylori attachment to gastric cells induces cytoskeletal rearrangements and tyrosine phosphorylation of host cell proteins. Proc Natl Acad Sci USA. 1996;93:1259-1264.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 204]  [Cited by in RCA: 193]  [Article Influence: 6.4]  [Reference Citation Analysis (0)]
21.  Wilkinson SM, Uhl JR, Kline BC, Cockerill FR. Assessment of invasion frequencies of cultured HEp-2 cells by clinical isolates of Helicobacter pylori using an acridine orange assay. J Clin Pathol. 1998;51:127-133.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 40]  [Cited by in RCA: 37]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
22.  Amieva MR, Salama NR, Tompkins LS, Falkow S. Helicobacter pylori enter and survive within multivesicular vacuoles of epithelial cells. Cell Microbiol. 2002;4:677-690.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 147]  [Cited by in RCA: 147]  [Article Influence: 6.1]  [Reference Citation Analysis (0)]
23.  Axon AT. Eradication of Helicobacter pylori. Scand J Gastroenterol Suppl. 1996;214:47-53; discussion 57-60.  [PubMed]  [DOI]  [Full Text]
24.  Belhoussine-Idrissi L, Boedeker EC. Helicobacter pylori infection: treatment. Curr Opin Gastroenterol. 2002;18:26-33.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 2]  [Article Influence: 0.1]  [Reference Citation Analysis (0)]
25.  Vakil N, Go MF. Treatment of Helicobacter pylori infection. Curr Opin Gastroenterol. 2000;16:32-39.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 2]  [Article Influence: 0.1]  [Reference Citation Analysis (0)]
26.  Zeng X, He LH, Yin Y, Zhang MJ, Zhang JZ. Deletion of cagA gene of Helicobacter pylori by PCR products. World J Gastroenterol. 2005;11:3255-3259.  [PubMed]  [DOI]
27.  Jeong JY, Mukhopadhyay AK, Dailidiene D, Wang Y, Velapatiño B, Gilman RH, Parkinson AJ, Nair GB, Wong BC, Lam SK. Sequential inactivation of rdxA (HP0954) and frxA (HP0642) nitroreductase genes causes moderate and high-level metronidazole resistance in Helicobacter pylori. J Bacteriol. 2000;182:5082-5090.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 97]  [Cited by in RCA: 99]  [Article Influence: 3.8]  [Reference Citation Analysis (0)]
28.  Montecucco C, Rappuoli R. Living dangerously: how Helicobacter pylori survives in the human stomach. Nat Rev Mol Cell Biol. 2001;2:457-466.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 421]  [Cited by in RCA: 360]  [Article Influence: 14.4]  [Reference Citation Analysis (0)]
29.  Bourke B, Jones NL. Pathogenesis of Helicobacter pylori infection. Curr Opin Gastroenterol. 2001;17:24-29.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 10]  [Article Influence: 0.4]  [Reference Citation Analysis (1)]
30.  Magalhães Queiroz DM, Luzza F. Epidemiology of Helicobacter pylori infection. Helicobacter. 2006;11 Suppl 1:1-5.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 84]  [Cited by in RCA: 77]  [Article Influence: 3.9]  [Reference Citation Analysis (0)]
31.  Sokurenko EV, Courtney HS, Maslow J, Siitonen A, Hasty DL. Quantitative differences in adhesiveness of type 1 fimbriated Escherichia coli due to structural differences in fimH genes. J Bacteriol. 1995;177:3680-3686.  [PubMed]  [DOI]
32.  Sokurenko EV, Chesnokova V, Dykhuizen DE, Ofek I, Wu XR, Krogfelt KA, Struve C, Schembri MA, Hasty DL. Pathogenic adaptation of Escherichia coli by natural variation of the FimH adhesin. Proc Natl Acad Sci USA. 1998;95:8922-8926.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 284]  [Cited by in RCA: 279]  [Article Influence: 10.0]  [Reference Citation Analysis (0)]
33.  Petersen AM, Krogfelt KA. Helicobacter pylori: an invading microorganism? A review. FEMS Immunol Med Microbiol. 2003;36:117-126.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 69]  [Cited by in RCA: 70]  [Article Influence: 3.0]  [Reference Citation Analysis (1)]
34.  Kwok T, Backert S, Schwarz H, Berger J, Meyer TF. Specific entry of Helicobacter pylori into cultured gastric epithelial cells via a zipper-like mechanism. Infect Immun. 2002;70:2108-2120.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 124]  [Cited by in RCA: 127]  [Article Influence: 5.3]  [Reference Citation Analysis (0)]
35.  Cabral MM, Mendes CM, Castro LP, Cartelle CT, Guerra J, Queiroz DM, Nogueira AM. Apoptosis in Helicobacter pylori gastritis is related to cagA status. Helicobacter. 2006;11:469-476.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 14]  [Cited by in RCA: 17]  [Article Influence: 0.9]  [Reference Citation Analysis (0)]
36.  Xiang Z, Censini S, Bayeli PF, Telford JL, Figura N, Rappuoli R, Covacci A. Analysis of expression of CagA and VacA virulence factors in 43 strains of Helicobacter pylori reveals that clinical isolates can be divided into two major types and that CagA is not necessary for expression of the vacuolating cytotoxin. Infect Immun. 1995;63:94-98.  [PubMed]  [DOI]
37.  Bagnoli F, Buti L, Tompkins L, Covacci A, Amieva MR. Helicobacter pylori CagA induces a transition from polarized to invasive phenotypes in MDCK cells. Proc Natl Acad Sci USA. 2005;102:16339-16344.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 227]  [Cited by in RCA: 214]  [Article Influence: 10.2]  [Reference Citation Analysis (0)]
38.  Higashi H, Yokoyama K, Fujii Y, Ren S, Yuasa H, Saadat I, Murata-Kamiya N, Azuma T, Hatakeyama M. EPIYA motif is a membrane-targeting signal of Helicobacter pylori virulence factor CagA in mammalian cells. J Biol Chem. 2005;280:23130-23137.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 103]  [Cited by in RCA: 103]  [Article Influence: 4.9]  [Reference Citation Analysis (1)]
39.  Selbach M, Moese S, Backert S, Jungblut PR, Meyer TF. The Helicobacter pylori CagA protein induces tyrosine dephosphorylation of ezrin. Proteomics. 2004;4:2961-2968.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 69]  [Cited by in RCA: 69]  [Article Influence: 3.1]  [Reference Citation Analysis (1)]
40.  Higashi H, Nakaya A, Tsutsumi R, Yokoyama K, Fujii Y, Ishikawa S, Higuchi M, Takahashi A, Kurashima Y, Teishikata Y. Helicobacter pylori CagA induces Ras-independent morphogenetic response through SHP-2 recruitment and activation. J Biol Chem. 2004;279:17205-17216.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 225]  [Cited by in RCA: 211]  [Article Influence: 9.6]  [Reference Citation Analysis (0)]
41.  Higashi H, Tsutsumi R, Muto S, Sugiyama T, Azuma T, Asaka M, Hatakeyama M. SHP-2 tyrosine phosphatase as an intracellular target of Helicobacter pylori CagA protein. Science. 2002;295:683-686.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 825]  [Cited by in RCA: 762]  [Article Influence: 31.8]  [Reference Citation Analysis (5)]
42.  Higashi H, Tsutsumi R, Fujita A, Yamazaki S, Asaka M, Azuma T, Hatakeyama M. Biological activity of the Helicobacter pylori virulence factor CagA is determined by variation in the tyrosine phosphorylation sites. Proc Natl Acad Sci USA. 2002;99:14428-14433.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 484]  [Cited by in RCA: 451]  [Article Influence: 18.8]  [Reference Citation Analysis (17)]
43.  Tomb JF, White O, Kerlavage AR, Clayton RA, Sutton GG, Fleischmann RD, Ketchum KA, Klenk HP, Gill S, Dougherty BA. The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature. 1997;388:539-547.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2809]  [Cited by in RCA: 2568]  [Article Influence: 88.6]  [Reference Citation Analysis (1)]
44.  Salama N, Guillemin K, McDaniel TK, Sherlock G, Tompkins L, Falkow S. A whole-genome microarray reveals genetic diversity among Helicobacter pylori strains. Proc Natl Acad Sci USA. 2000;97:14668-14673.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 454]  [Cited by in RCA: 401]  [Article Influence: 15.4]  [Reference Citation Analysis (1)]
45.  Philpott DJ, Belaid D, Troubadour P, Thiberge JM, Tankovic J, Labigne A, Ferrero RL. Reduced activation of inflammatory responses in host cells by mouse-adapted Helicobacter pylory isolates. Cell Microbiol. 2002;4:285-296.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 103]  [Cited by in RCA: 101]  [Article Influence: 4.2]  [Reference Citation Analysis (0)]
46.  Cover TL. The vacuolating cytotoxin of Helicobacter pylori. Mol Microbiol. 1996;20:241-246.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 220]  [Cited by in RCA: 191]  [Article Influence: 6.4]  [Reference Citation Analysis (0)]
47.  Figueiredo C, Machado JC, Yamaoka Y. Pathogenesis of Helicobacter pylori Infection. Helicobacter. 2005;10 Suppl 1:14-20.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 42]  [Cited by in RCA: 44]  [Article Influence: 2.1]  [Reference Citation Analysis (0)]
48.  Terebiznik MR, Vazquez CL, Torbicki K, Banks D, Wang T, Hong W, Blanke SR, Colombo MI, Jones NL. Helicobacter pylori VacA toxin promotes bacterial intracellular survival in gastric epithelial cells. Infect Immun. 2006;74:6599-6614.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 93]  [Cited by in RCA: 90]  [Article Influence: 4.5]  [Reference Citation Analysis (0)]
Footnotes

S- Editor Wang J L- Editor Zhu LH E- Editor Lu W

Write to the Help Desk