BPG is committed to discovery and dissemination of knowledge
Liver Cancer Open Access
©2007 Baishideng Publishing Group Co., Limited. All rights reserved.
World J Gastroenterol. Jun 28, 2007; 13(24): 3323-3332
Published online Jun 28, 2007. doi: 10.3748/wjg.v13.i24.3323
Correlation analysis of liver tumor-associated genes with liver regeneration
Cun-Shuan Xu, College of Life Science, Henan Normal University, Xinxiang 453007, Henan Province, China
Shou-Bing Zhang, Xiao-Guang Chen, Key Laboratory for Cell Differentiation Regulation, Xinxiang 453007, Henan Province, China
Salman Rahman, Laboratory of Thrombosis and Vascular Remodelling, Division of Cardiovascular Medicine, King’s College London School of Medicine, St Thomas’ Hospital, Lambeth Palace Road, London SE1 7EH, United Kingdom
Author contributions: All authors contributed equally to the work.
Supported by the National Basic Research 973 Pre-research Program of China, No. 2006CB708506
Correspondence to: Cun-Shuan Xu, Professor, College of Life Science, Henan Normal University, Xinxiang 453007, Henan Province, China. xucs@x263.net
Telephone: +86-373-3326001 Fax: +86-373-3326524
Received: May 8, 2007
Revised: May 11, 2007
Accepted: May 12, 2007
Published online: June 28, 2007

Abstract

AIM: To study at transcriptional level the similarities and differences of the physiological and biochemical activities between liver tumor (LT) and regenerating liver cells.

METHODS: LT-associated genes and their expression changes in LT were obtained from databases and scientific articles, and their expression profiles in rat liver regeneration (LR) were detected using Rat Genome 230 2.0 array. Subsequently their expression changes in LT and LR were compared and analyzed.

RESULTS: One hundred and twenty one LT-associated genes were found to be LR-associated. Thirty four genes were up-regulated, and 14 genes were down-regulated in both LT and regenerating liver; 20 genes up-regulated in LT were down-regulated in regenerating liver; 21 up-regulated genes and 16 down-regulated genes in LT were up-regulated at some time points and down-regulated at others during LR.

CONCLUSION: Results suggested that apoptosis activity suppressed in LT was still active in regenerating liver, and there are lots of similarities and differences between the LT and regenerating liver at the aspects of cell growth, proliferation, differentiation, migration and angiogenesis.

Key Words: Partial hepatectomy; Rat Genome 230 2.0 Array; Apoptosis; Liver regeneration-associated gene; Liver tumor-associated gene



INTRODUCTION

The liver is an organ with considerable regenerative capacity[1]. After partial hepatectomy (PH)[2], about 95% of quiescent hepatocytes re-enter synchronously into the cell cycle to replenish the missing hepatocytes[3,4]. Whereas excessive liver mass is regulated by apoptosis[5], this process is called liver regeneration (LR)[3]. The regeneration process, which according to cellular physiological and biochemical activities is divided into the following parts: initiation (0.5-4 h after PH), transition from G0 to G1 (4-6 h after PH), cell proliferation (6-66 h after PH), and cell differentiation and reorganization of the structure-function (72-168 h after PH)[6], or according to time course, into forepart (0.5-4 h after PH), prophase (6-12 h after PH), metaphase (16-66 h after PH) and anaphase (72-168 h after PH), involves various physiological and biochemical activities such as cell activation, de-differentiation, proliferation and its regulation, re-differentiation, and rebuilding of the structure and function[7,8]. Actually, some biological activities in LR including cell proliferation and growth are also observed in liver tumor (LT). It is usually thought that tumorigenesis is mainly ascribed to the anomalous activation of the genes having positive effects on LT cell proliferation, growth, invasion and LT angiogenesis, as well as the genes suppressing LT cell apoptosis, and/or inactivation of the inhibitory genes related to LT cell proliferation, growth, invasion and LT angiogenesis[9], and the promotive genes of LT cell differentiation and apoptosis. To elucidate the intrinsic differences between the two events at transcriptional level, we checked the expression profiles of above genes in regenerating livers following 2/3 hepatectomy utilizing the Rat Genome 230 2.0 Array containing 249 LT-associated genes, and primarily analyzed their expression changes and actions in LR, as well as their relevance with LR.

MATERIALS AND METHODS
Regenerating liver preparation

Healthy Sprague-Dawley rats weighing 200-250 g were obtained from the Animal Center of Henan Normal University. The 276 rats were separated into 46 groups randomly, 23 hepatectomized groups and 23 sham-operation (SO) groups,and each group included 6 rats. PH was performed according to Higgins and Anderson[2], by which the left and middle lobes of liver were removed. Rats were killed by cervical vertebra dislocation at 0, 0.5, 1, 2, 4, 6, 8, 12, 16, 18, 24, 30, 36, 42, 48, 54, 60, 66, 72, 96, 120, 144 and 168 h after PH and the regenerating livers were observed at corresponding time point. The livers were rinsed three times in PBS at 4°C, and then total 1-2 g livers (100-200 mg livers from middle parts of right lobe of each sample, 6 samples per group) were gathered and mixed together, then stored at -80°C. The SO group was the same as hepatectomized group except the liver lobes were not removed. The laws of animal protection of China were enforced strictly.

RNA isolation and purification

Total RNA was isolated from frozen livers according to the manual of Trizol reagent (Invitrogen Corporation, Carlsbad, California, USA)[10] and then purified base on the guide of RNeasy mini kit (Qiagen, Inc, Valencia, CA, USA)[11]. Total RNA samples were checked to exhibit a 2:1 ratio of 28S rRNA to 18S rRNA intensities by agarose electrophoresis (180 V, 0.5 h). Total RNA concentration and purity were estimated by optical density measurements at 260/280 nm[12].

cDNA, cRNA synthesis and purification

One to eight gram total RNA as template was used for cDNA synthesis. cDNA purification was based on the way established by Affymetrix[13]. cRNA labeled with biotin was synthesized using cDNA as the template, and cDNA and cRNA were purified according to the purification procedure of GeneChip Analysis[13]. Measurement of cDNA, cRNA concentration and purity were the same as above.

cRNA fragmentation and microarray detection

Fifty μL (1 μg/μL) cRNA incubated with 5 × fragmentation buffer at 94°C for 35 min was digested into 35-200 bp fragments. The hybridization buffer prepared according to the way Affymetrix provided was added to the prehybridized Rat Genome 230 2.0 array produced by Affymetrix, then hybridization was carried out at 45°C for 16 h on a rotary mixer at 60 rpm. The microarray was washed and stained by GeneChip fluidics station 450 (Affymetrix Inc., Santa Clara, CA , USA). The chips were scanned by GeneChip Scan 3000 (Affymetrix Inc., Santa Clara, CA, USA), and the signal values of gene expression were observed[14].

Microarray data analysis

The normalized signal values, signal detections (P, A, M) and experiment/control (Ri) were obtained by quantifying and normalizing the signal values using GCOS (GeneChip operating software) 1.2[14].

Normalization of the microarray data

To minimize the technical error from the microarray analysis, each sample was hybridized three times to the gene chips. The average value of three measurements was normalized, and statistics and cluster analyses were conducted on these values with GeneMath, GeneSpring (Silicon Genetics, San Carlos, CA) and Microsoft Excel Software (Microsoft, Redmond, WA)[14-16].

Verification of array results by RT-PCR

Primer and probe sequences were designed by primer express 2.0 software according to mRNA sequences of three target genes jun, myc, tp53 and internal control ®-actin gene (GenBank number: BC078738, NM_012603, AY009504 and NM_031144) and synthesized by Shanghai GeneCore BioTechnologies Co. Ltd (Table 1).

Table 1 Primer and probe sequences used to validate the microarray analysis by quantitative RT-PCR.
GenesPrimer sequences TmAmplifiedproducts
β-actinFP: CCTGGCACCCAGCACAAT58°C221 bp
RP: GCTGATCCACATCTGCTGGAA58°C
Probe: ATCAAGATCATTGCTCCTCCTGAGCGC68°C
junFP: TGCAAAGATGGAAACGACCTT58°C76 bp
RP: GCCGTAGGCGCCACTCT59°C
Probe: TACGACGATGCCCTCAACGCCTC68°C
mycFP: CCCCTAGTGCTGCATGAAGAG59°C95 bp
RP: TCCACAGACACCACATCAATTTC58°C
Probe: CACCAGCAGCGACTCTGAAGAAGAACA68°C
tp53FP: ATGAGGCCTTGGAATTAAAGGAT58°C98 bp
RP: CGTAGACTGGCCCTTCTTGGT59°C
Probe: CAGGGCTCACTCCAGCTACCCGAA68°C
Identification of genes associated with LR

Nomenclatures such as LT, hepatoma, hepatocellular carcinoma, hepatocarcinogenesis, cholangiocarcinoma and so on were input into the databases at NCBI (http://www. ncbi.nlm.nih.gov) and RGD (rgd. mcw.edu) to identify rat, mouse and human genes associated with LT. Then these LT-associated genes were reconfirmed through literature searches of the pertinent articles. Besides the rat genes, other genes, that are now thought existing in mouse and/or human and showed a greater than two-fold change in the rat regenerating livers, were referred to as rat homologous genes. Genes that displayed reproducible results with three independent analyses using Rat Genome 230 2.0 array and that showed a greater than two-fold change in expression at least at one time point as a significant difference (P≤ 0.05) or an extremely significant difference (P≤ 0.01) between PH and SO, were included as being associated with LR.

RESULTS
Comparison between the quantitative RT-PCR results and the microarray results

The quantitative RT-PCR results of three chosen genes jun, myc and tp53 at 0, 0.5, 2, 4, 6, 12, 24, 30, 36 and 96 h after partial hepatectemy (PH) were compared with Rat Genome 230 2.0 Array results (Figure 1) in order to verify validity of this chip. According to quantitative RT-PCR results, myc was up-regulated at 0.5-12 and 30-96 h after PH with the highest point of 10.33 folds higher than control at 4 h; jun expression was significantly up-regulated at 0.5-4 h after PH, showing the greatest abundance of 4.28-fold of control at 0.5 h; and tp53 was up-regulated at 96 h after PH. The result of RT-PCR suggested that expression profiles of these three genes were basically similar to that of array, which indicated that Rat Genome 230 2.0 Array had great reliability.

Figure 1
Figure 1 Comparison of relative mRNA levels in regenerating liver detected by Affymetrix Rat Genome 230 2. 0 microarray and real-time PCR analysis A: myc; B: jun; C: tp53; Real line represents quantitative real time PCR results; broken line indicates Rat Genome 230 2.0 microarray results.
Expression changes of the associated-genes in LT and LR

Among 252 genes associated with LT obtained by searching the related data in databases such as NCBI, RGD etc., 249 genes were contained in the Rat Genome 230 2.0 Array. 121 of 249 genes yielded meaningful expression changes on at least single time point after PH, showed significant or extremely significant difference between PH and SO, and displayed reproducible results with three independent analyses with Rat Genome 230 2.0 Array, suggesting that these genes were associated with LR. The data listed below indicated that expression trends of 48 genes in LT was similar to that in LR, whereas expression of 34 genes in the former underwent opposite trend comparing with in the latter, and expression changes of 39 genes in LT were similar to that in some time point of LR. Specifically, the same trend towards up regulation of 34 genes and down regulation of 14 genes were exhibited in both LT and LR; 20 up-regulated genes in LT showed down-regulation during LR, and 14 down-regulated genes in LT revealed up-regulation during LR; 23 up-regulated genes and 16 down-regulated genes in LT were up-regulated at some time points and down-regulated at others during LR (Table 2).

Table 2 Expression abundance of 121 liver tumor-associated genes during liver regeneration.
NameGeneAssociatedFoldComparison
Abbr. todifferenceLT.RRL.
The same in gene expression trend
Cyclin A2*Ccna2245.1
WEE1 homologWee1220.9
Cyclin E1Ccne1218.5
Proliferating cell nuclear antigenPcna210.6
Smoothened homologSmo1,23
Protein NIMA-interacting 1Pin122.5
Cyclin-dependent kinase 4Cdk422.5
NIMA (never in mitosis gene a)-related kinase 6Nek622.3
Aryl-hydrocarbon receptorAhr12.2
Serpin peptidase inhibitor, clade E, member 1Serpine1216.7
Heat shock 27 kDa protein 1Hspb1211
Transforming growth factor, beta 1Tgfb124
GranulinGrn22.3
Myeloid cell leukemia sequence 1Mcl12,34.3
WNT1 inducible signaling pathway protein 1Wisp12,314.9
Selectin ESele212.9
Metastasis associated 1Mta129.6
TIMP metallopeptidase inhibitor 1Timp128.6
Integrin, alpha VItgav25.2
Discs, large homolog 7Dlg724.3
Lectin, galactoside-binding, soluble, 1Lgals123.7
ADAM metallopeptidase domain 17Adam1722.7
Integrin, beta 1Itgb122.6
Calponin 1, basic, smooth muscleCnn127
Macrophage migration inhibitory factorMif23.2
Collagen, type XVIII, alpha 1Col18a123.1
Connective tissue growth factor*Ctgf213.9
Hexokinase 2Hk228.9
Chemokine (C-C motif) ligand 20Ccl2028
v-jun sarcoma virus 17 oncogene homolog*Jun26.9
Methyl-CpG binding domain protein 2Mbd223
TERF1 (TRF1)-interacting nuclear factor 2Tinf212.8
FMS-like tyrosine kinase 1*Flt122.3
Proteasome 26S subunit, non-ATPase, 10Psmd1022
Phosphatase and tensin homologPten1,20.5
Cold shock domain protein ACsda10.5
cAMP responsive element binding protein 3-like 3Creb3l310.4
v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homologKit20.4
Gap junction protein, beta 1, 32 kDaGjb11,20.2
Trefoil factor 1Tff130.1
Caspase 9, apoptosis-related cysteine peptidaseCasp920.5
Deleted in liver cancer 1Dlc11,20.5
B-cell CLL/lymphoma 2Bcl220.3
Inhibitor of DNA binding 1Id11,20.3
Protein tyrosine phosphatase, receptor type, HPtprh20.2
CD74 molecule, major histocompatibility complex, class II invariant chainCd7420.4
Hepatocyte growth factor*Hgf1,20.4
Mannose-binding lectin (protein C) 2, solubleMbl220.2
The contrary in gene expression trend
Myelocytomatosis oncogeneMyc1,219.7
Sprouty homolog 2Spry228.1
Growth arrest and DNA-damage-inducible, betaGadd45b255.7
Serine peptidase inhibitor, Kunitz type, 2Spint227.2
MAD homolog 4Smad41,23
Fibrinogen-like 1Fgl122.2
Caspase 8, apoptosis-related cysteine peptidaseCasp8210.6
Interferon gammaIfng1,26.5
Tumor protein p53Tp531,2,32.9
Early growth response 1*Egr1218.6
Transcription factor 1, hepaticTcf126.8
O-6-methylguanine-DNA methyltransferaseMgmt24.3
Glutathione S-transferase theta 1Gstt123.2
Glutathione S-transferase M1Gstm122.2
Wingless-type MMTV integration site family, member 1Wnt120.5
SHC (Src homology 2 domain containing)Shc120.5
Transforming protein 1
Inhibitor of kappaB kinase betaIkbkb1,20.3
FK506 binding protein 4, 59 kDaFkbp420.3
Transcription factor 7-like 2Tcf7l220.2
v-erb-b2 erythroblastic leukemia viral oncogeneErbb230.1
Homolog 2
Heat shock 70kDa protein 1AHspa1a20.2
Heat shock 70kDa protein 5Hspa51,20.1
High mobility group AT-hook 1Hmga120.4
Ras homolog gene family, member CRhoc20.3
CortactinCttn20.1
Serpin peptidase inhibitor, clade B, member 3Serpinb320.1
Ephrin-B1Efnb120.4
Coagulation factor IIF21,20.3
Trefoil factor 3Tff320.3
Forkhead box A2Foxa220.4
Glycogen synthase kinase 3 betaGsk3b1,20.4
ATP-binding cassette, sub-family B, member 1A*Abcb1a10.2
Solute carrier family 2 , member 1*Slc2a120.2
Apolipoprotein E*Apoe20.1
The comparable in gene expression trend
Lysosomal-associated protein transmembrane 4BLaptm4b22.3,0.5↑↓
Met proto-oncogene*Met1,2,32.3,0.4↑↓
Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (p105)Nfkb122.3,0.4↑↓
Acyl-CoA synthetase long-chain family member 4Acsl422.1,0.4↑↓
X-box binding protein 1Xbp114.3,0.3↑↓
Nerve growth factor, beta polypeptideNgfb23.7,0.5↑↓
Stearoyl-Coenzyme A desaturase 1Scd11,23.5,0.3↑↓
Telomerase reverse transcriptaseTert1,2,35.3,0.3↑↓
Telomeric repeat binding factor (NIMA-interacting) 1Terf112.2,0.4↑↓
Cadherin 17Cdh17226.1,0.2↑↓
Glycoprotein (transmembrane) nmbGpnmb29.2,0.3↑↓
Claudin 10Cldn1026.5,0.3↑↓
Plasminogen activator, urokinasePlau23,0.4↑↓
Secreted phosphoprotein 1Spp12,32.7,0.5↑↓
Alpha-2-macroglobulin*A2m246.2,0.4↑↓
Chemokine (C-C motif) receptor 1Ccr1227.9,0.4↑↓
Matrix metallopeptidase 9Mmp91,29.5,0.5↑↓
Angiopoietin 1*Angpt129.2,0.2↑↓
Mucin 1, cell surface associatedMuc12,36.8,0.2↑↓
Heparanase*Hpse26.3,0.3↑↓
Megalencephalic leukoencephalopathy with subcortical cysts 1Mlc124.3,0.4↑↓
Kinase insert domain protein receptor*Kdr22.4,0.4↑↓
Prostaglandin-endoperoxide synthase 2Ptgs21,2,32.1,0.1↑↓
Dual specificity phosphatase 1Dusp126,0.4↑↓
Cyclin-dependent kinase inhibitor 1CCdkn1c22.8,0.1↑↓
Growth arrest and DNA-damage-inducible, gammaGadd45g28,0.4↑↓
Hepatic nuclear factor 4, alphaHnf4a24.5,0.1↑↓
Runt-related transcription factor 3Runx31,24.3,0.5↑↓
Insulin-like growth factor binding protein 3Igfbp31,22.7,0.4↑↓
Suppressor of cytokine signaling 3*Socs322.5,0.1↑↓
Suppressor of cytokine signaling 1*Socs11,22.4,0.5↑↓
Fibroblast growth factor 2Fgf21,22.1,0.5↑↓
Fragile histidine triad geneFhit1,27.8,0.1↑↓
Gamma-glutamyltransferase 1Ggt123.4,0.2↑↓
Bone morphogenetic protein 7Bmp723,0.4↑↓
E74-like factor 1 (ets domain transcription factor)Elf123,0.4↑↓
CD80 moleculeCd8023,0.3↑↓
Glycine N-methyltransferaseGnmt22.5,0.4↑↓
Acyl-Coenzyme A oxidase 1, palmitoylAcox122.3,0.5↑↓
The relationship of LT-associated genes with LR

According to function feature and expression profiles of total 121 LT-associated genes in LR, they were divided into six classes and twenty-nine subclasses (Figure 2), and their expression changes in LR were present. Genes up-regulated in both LT and regenerating liver include nine cell proliferation-associated genes (1), four cell growth-associated genes (2), one apoptosis-associated gene (3), nine cell migration-associated genes (4), three angiogenesis-associated genes (5), and eight genes involved in other biological processes (6); Genes down-regulated in both LT and regenerating liver include six cell proliferation-associated genes (7), three apoptosis-associated genes (8), two differentiation-associated genes (9), and three genes with other functions (10); Genes down-regulated in LT but up-regulated in LR include two cell proliferation-associated genes (11), four cell growth-associated genes (12), three apoptosis-associated gene (13), and another five genes having other biological activities (14); Genes up-regulated in LT but down-regulated in LR include six cell proliferation-associated genes (15), two cell growth-associated genes (16), one apoptosis-associated gene (17), three cell migration-associated gene (18), three angiogenesis-associated genes (19), and five genes with other functions (20); Genes up-regulated in LT but up-regulated at some time points and down-regulated at others in LR include four cell proliferation-associated genes (21), three cell growth-associated genes (22), two telomerase-associated genes (23), five cell migration-associated genes (24), and nine genes participating in other actions (25). Genes down-regulated in LT but up-regulated at some time points and down-regulated at others during LR include two cell proliferation-associated genes (26), six cell growth-associated genes (27), one apoptosis-associated gene (28), and seven genes related to biological events differed from the above-mentioned actions (29).

Figure 2
Figure 2 Correlation analysis of 121 liver tumor-associated genes with liver regeneration. Twenty-nine subcategories were obtained by the analysis for detection data of Rat Genome 230 2.0 array with Microsoft Excel. 1-6: 34 genes up-regulated in both liver tumor (LT) and rat regenerating liver (RRL); 7-10: 14 genes down-regulated in both LT and RRL; 11-14: 14 genes down-regulated in LT but up-regulated in RRL; 15-20: 20 genes up-regulated in LT but down-regulated in RRL; 21-25: 23 up-regulated genes in LT were up-regulated at some time points and down-regulated at others in RRL; 26-29: 16 down-regulated genes in LT were up-regulated at some time points and down-regulated at others in RRL. X-axis represents recovery time after PH (h); Y-axis shows logarithm ratio of the signal values of genes at each time point to control.
DISCUSSION

Generally, cell proliferation and growth was done in both LT and LR, but the former are malignant, and the latter are controlled stringently. According to our data, proliferation-promoting genes pcna, ccne1, cdk4, ahr, wee1, ccna2, pin1, nek6 and smo[17-22] were up-regulated in both LT and LR, and proliferation-inhibiting genes creb3l3, pten, kit, gjb1, tff1 and csda[23-28], were down-regulated in both, indicating that these genes promote cell proliferation in the two events. Notably, the abundance of CCNA2 mRNA in LT was approximately five-fold higher than that in normal liver[17], and it reached its peak with 45 folds of control at 66 h after PH, which might be associated with an increased proportion of regenerated hepatocytes. Growth-promoting genes hspb1, grn, tgfb1 and serpine1[29-31], whose expression levels were elevated in LT, were up-regulated at metaphase of LR. Among these four genes, serpine1 having the highest expression (16.7 folds higher than control) at 6 h following PH might explain why it played an important role in growth of the regenerated hepatocytes. Dysregulated expression of anti-apoptosis gene bcl-2 was present in LT as well as at metaphase and anaphase of LR, and another anti-apoptotic gene mcl1[32], whose change trend toward up-regulation in LT was identical to that in LR; and down-regulation of pro-apoptosis genes casp9 and dlc1[33,34] occurred in LT and the metaphase of LR, which supported the idea that mcl1, casp9 and dlc1 might are related with cell survival in the two events. The differentiation-related genes id1 and ptprh[35,36] down-regulation in LT and at forepart, metaphase and anaphase of LR suggested that they failed to promote cell differentiation in both events. Up-regulation of enhancement of hepatoma cell migration-related genes itgav, itgb1, adam17, dlg7, sele, mta1, wisp1 and lgals1[37-43] in LT and the entire LR, especially a sustained high-level expression (12-fold higher than control) of wisp1 at 48-60 h post-PH might imply the active cell migration in both LT and LR. According to up-regulated expression pattern in LT and almost the whole LR, metallopeptidase inhibitor timp1 was supposed to perform other biological functions except cell migration in the two events. Mif inducing angiogenesis of LT[44], cnn1 enhancing differentiation of vascular smooth muscle cells[45] and apoptosis-inhibiting gene col18a1 encoding endostatin[46] were up-regulated both in LT and in forepart of LR, which was presumably that the three genes might co-regulate angiogenesis in LT and LR.

Study demonstrated that six pro-proliferation genes ikbkb, shc1, erbb2, fkbp4, wnt1, tcf7l2[47-51] up-regulated in LT were down-regulated during LR, at the same time, the down-regulated genes myc and spry2 possessing anti-proliferation effect[52,53] in LT were up-regulated almost during the whole LR; two growth-promoting genes hspa5 and hspa1a[29,54] and four growth inhibitory genes gadd45b, fgl1, spint2 and smad4[55-58] were respectively up-regulated and down-regulated in LT, whose expression correspondingly underwent opposite trend at metaphase of LR comparing with LT, which was supposed to be closely associated with the differences in proliferation and growth between hepatoma cells and regenerating hepatocytes. Particularly, the expression abundance of gadd45b in human hepatocellular carcinoma was fifteen-fold lower than control[55], just the contrary, its expression reached climax (nearly 56-fold over the control) at 2 h in rat LR, demonstrating there was a significant distinction in gadd45b expression change between normal and transforming liver cells. The down-regulated pro-apoptotic genes tp53, ifng and casp8[59-61] and the up-regulated apoptosis-inhibitory gene serpinb3[62] in LT were respectively up-regulated and down-regulated at metaphase and anaphase of LR might account for the suppression of apoptosis in LT and enhancement of apoptosis at metaphase and anaphase of LR. In addition, casp8, inactivated caused by frame-shift mutation in hepatocellular carcinoma[61], was up-regulated to its highest levels (10.6 folds higher than control) at 48 h post-PH, and expression of serpinb3 declined to the lowest point (11.4 folds lower than control) at 48 h, signifying the important regulatory effect of the two genes on liver mass. Contribution of efnb1 and tff3 in neovasculargenesis activity[63,64] and the crucial role for f2 in maintenance of vascular integrity[65] were helpful for understanding the hypothesis that the three up-regulated genes in LT down-regulated at metaphase and anaphase of LR implied the control of blood-vessel growth serving as one of modulation pathways of regenerated liver mass. Three hepatoma cell migration and invasion-associated genes hmga1, cttn and rhoc up-regulated in LT[66,67] and down-regulated in LR possibly showed the stronger migration ability of hepatoma cells.

Four up-regulated in LT genes promoting hepatoma cell proliferation including met, laptm4b, nfkb1 and acsl4[68,69], revealed down-regulation at metaphase and up-regulation at anaphase of LR, and another two inhibitory genes dusp1 and cdkn1c[70] were up/down-regulated in LR, i.e. the former was up-regulated at 0.5-12 and 24 h, and down-regulated at 54-60 h, while the latter was down-regulated at 6-18 h and up-regulated at 30 and 42 h; Three up-regulated scd1, xbp1 and ngfb genes involved in hepatoma cell growth in LT[54,71,72] were up-regulated at forepart, prophase and metaphase, and down-regulated at some time points in the late phase of LR, while another six negative regulatory genes including socs1, socs3, gadd45g, igfbp3, runx3 and hnf4a[73-77] down-regulated in LT had a significant increase in expression at some time points and significant decrease at others during LR. The more complicated expression of these genes during the proliferation and growth of regenerating liver cells comparing with that of hepatoma cells concluded from the above results was presumably consistent with the further improved control mechanism upon proliferation and growth of regenerating liver cells than that of hepatoma cells. Telomerase activity of TERT was interfered by terf1 expression product[78], and the two were up-regulated in both LT and the metaphase of LR, while down-regulated at anaphase, indicating that the balance of quantity of the two gene products was essential for maintaining telomere stability. The up-regulated genes spp1, plau and gpnmb promoting hepatoma cell migration and invasion[79,80] as well as the up-regulated intercellular junction-involved cdh17 and cldn10 genes[47,81] were up-regulated at forepart, prophase and some time points after 16h, and down-regulated at other points after 16 h, possibly illustrating that the similar cell migration and interactions in LT occurred at forepart and prophase of LR, however the difference emerged when entering the metaphase of LR. The dysregulated gene fgf2[82] promoting hepatoma cell apoptosis in LT was up-regulated at 4 h post-PH, consistent with the enhanced apoptotic action of regenerating liver cell at the forepart of LR, demonstrating that it acted as a key gene involved in the regulation of apoptosis.

In conclusion, at transcriptional level, while decrease of apoptosis occurring in liver tumors, the process was still going on in LR; as far as cell growth, proliferation, differentiation, migration and angiogenesis are concerned, not only resemblances but differences exist between LT and LR. Especially, expressions of the genes, such as ccna2, serpine1, wisp1, gadd45b, casp8 and serpinb3, display marked changes in two events, so their actions deserve the further study. Of course, the process of DNA→mRNA→protein→function could be influenced by many factors including gene mutation, protein interaction etc. Therefore, the further analyses are required for confirming the above results using techniques such as gene addition, knock-out, RNAi, etc.

COMMENTS
Background

The liver is susceptible to tumorigenesis, and it’s also an organ with strong regenerating capacity. Both hepatocarcinogenesis and LR are associated with cell proliferation and growth.

Research frontiers

Most research works had been done on the mechanism of hepatocarcinogenesis and LR, but heretofore no research report was found in investigating the correlation between them.

Innovations and breakthroughs

121 genes associated with both hepatocarcinogenesis and LR were found. Their expression changes in LR were analyzed by Rat Genome 230 2.0 Array, and their expression similarities and differences in hepatocarcinogenesis and LR were compared.

Applications

Our results may provide basic and useful data for further research on both LT therapy and LR mechanism.

Terminology

PH model, an effective surgical operation to trigger LR, was established by Higgins and Anderson in 1931. The hepatectomized rat, whose left and middle lobes of liver were removed, can recover its liver mass after about a week, so it’s widely used to investigate LR mechanism.

Peer review

This is an important work examining common genes associated with HCC and LR.

References
1.  Michalopoulos GK, DeFrances M. Liver regeneration. Adv Biochem Eng Biotechnol. 2005;93:101-134.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 54]  [Cited by in RCA: 77]  [Article Influence: 3.7]  [Reference Citation Analysis (3)]
2.  Higgins GM, Anderson RM. Experimental pathology of the liver: restoration of the liver of the white rat following partial surgical removal. Arch Pathol. 1931;12:186-202.  [PubMed]  [DOI]
3.  Fausto N, Campbell JS, Riehle KJ. Liver regeneration. Hepatology. 2006;43:S45-S53.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1271]  [Cited by in RCA: 1199]  [Article Influence: 60.0]  [Reference Citation Analysis (10)]
4.  Suzuki T, Tsukamoto I. Apoptosis induced by 5-(N,N-hexamethylene)-amiloride in regenerating liver after partial hepatectomy. Eur J Pharmacol. 2004;503:1-7.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 6]  [Article Influence: 0.3]  [Reference Citation Analysis (0)]
5.  Lai HS, Chen Y, Lin WH, Chen CN, Wu HC, Chang CJ, Lee PH, Chang KJ, Chen WJ. Quantitative gene expression analysis by cDNA microarray during liver regeneration after partial hepatectomy in rats. Surg Today. 2005;35:396-403.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 16]  [Cited by in RCA: 16]  [Article Influence: 0.8]  [Reference Citation Analysis (0)]
6.  Xu CS, Chang CF, Yuan JY, Li WQ, Han HP, Yang KJ, Zhao LF, Li YC, Zhang HY, Rahman S. Expressed genes in regenerating rat liver after partial hepatectomy. World J Gastroenterol. 2005;11:2932-2940.  [PubMed]  [DOI]
7.  Fausto N. Liver regeneration. J Hepatol. 2000;32:19-31.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 954]  [Cited by in RCA: 885]  [Article Influence: 34.0]  [Reference Citation Analysis (5)]
8.  Xu CS, Zhao LF, Yang KJ, Zhang JB. The origination and action of the hepatic stems cells. Shi Yan Sheng Wu Xue Bao. 2004;37:72-77.  [PubMed]  [DOI]
9.  Laurent-Puig P, Zucman-Rossi J. Genetics of hepatocellular tumors. Oncogene. 2006;25:3778-3786.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 259]  [Cited by in RCA: 246]  [Article Influence: 12.3]  [Reference Citation Analysis (0)]
10.  Knepp JH, Geahr MA, Forman MS, Valsamakis A. Comparison of automated and manual nucleic acid extraction methods for detection of enterovirus RNA. J Clin Microbiol. 2003;41:3532-3536.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 115]  [Cited by in RCA: 101]  [Article Influence: 4.4]  [Reference Citation Analysis (0)]
11.  Nuyts S, Van Mellaert L, Lambin P, Anné J. Efficient isolation of total RNA from Clostridium without DNA contamination. J Microbiol Methods. 2001;44:235-238.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 38]  [Cited by in RCA: 34]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
12.  Arkin A, Ross J, McAdams HH. Stochastic kinetic analysis of developmental pathway bifurcation in phage lambda-infected Escherichia coli cells. Genetics. 1998;149:1633-1648.  [PubMed]  [DOI]
13.  Li L, Roden J, Shapiro BE, Wold BJ, Bhatia S, Forman SJ, Bhatia R. Reproducibility, fidelity, and discriminant validity of mRNA amplification for microarray analysis from primary hematopoietic cells. J Mol Diagn. 2005;7:48-56.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 38]  [Cited by in RCA: 35]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
14.  Collins JF. Gene chip analyses reveal differential genetic responses to iron deficiency in rat duodenum and jejunum. Biol Res. 2006;39:25-37.  [PubMed]  [DOI]
15.  Eisen MB, Spellman PT, Brown PO, Botstein D. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci USA. 1998;95:14863-14868.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 12380]  [Cited by in RCA: 10351]  [Article Influence: 369.7]  [Reference Citation Analysis (5)]
16.  Werner T. Cluster analysis and promoter modelling as bioinformatics tools for the identification of target genes from expression array data. Pharmacogenomics. 2001;2:25-36.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 50]  [Cited by in RCA: 46]  [Article Influence: 1.8]  [Reference Citation Analysis (0)]
17.  Masaki T, Shiratori Y, Rengifo W, Igarashi K, Yamagata M, Kurokohchi K, Uchida N, Miyauchi Y, Yoshiji H, Watanabe S. Cyclins and cyclin-dependent kinases: comparative study of hepatocellular carcinoma versus cirrhosis. Hepatology. 2003;37:534-543.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 173]  [Cited by in RCA: 163]  [Article Influence: 7.1]  [Reference Citation Analysis (0)]
18.  Moennikes O, Loeppen S, Buchmann A, Andersson P, Ittrich C, Poellinger L, Schwarz M. A constitutively active dioxin/aryl hydrocarbon receptor promotes hepatocarcinogenesis in mice. Cancer Res. 2004;64:4707-4710.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 187]  [Cited by in RCA: 165]  [Article Influence: 7.5]  [Reference Citation Analysis (0)]
19.  Payraudeau V, Sarsat JP, Sobczak J, Bréchot C, Albaladéjo V. Cyclin A2 and c-myc mRNA expression in ethinyl estradiol induced liver proliferation. Mol Cell Endocrinol. 1998;143:107-116.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 12]  [Cited by in RCA: 13]  [Article Influence: 0.5]  [Reference Citation Analysis (0)]
20.  Chen J, Li L, Zhang Y, Yang H, Wei Y, Zhang L, Liu X, Yu L. Interaction of Pin1 with Nek6 and characterization of their expression correlation in Chinese hepatocellular carcinoma patients. Biochem Biophys Res Commun. 2006;341:1059-1065.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 34]  [Cited by in RCA: 34]  [Article Influence: 1.7]  [Reference Citation Analysis (1)]
21.  Yin MJ, Shao L, Voehringer D, Smeal T, Jallal B. The serine/threonine kinase Nek6 is required for cell cycle progression through mitosis. J Biol Chem. 2003;278:52454-52460.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 104]  [Cited by in RCA: 89]  [Article Influence: 3.9]  [Reference Citation Analysis (0)]
22.  Sicklick JK, Li YX, Jayaraman A, Kannangai R, Qi Y, Vivekanandan P, Ludlow JW, Owzar K, Chen W, Torbenson MS. Dysregulation of the Hedgehog pathway in human hepatocarcinogenesis. Carcinogenesis. 2006;27:748-757.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 225]  [Cited by in RCA: 215]  [Article Influence: 10.8]  [Reference Citation Analysis (1)]
23.  Chin KT, Zhou HJ, Wong CM, Lee JM, Chan CP, Qiang BQ, Yuan JG, Ng IO, Jin DY. The liver-enriched transcription factor CREB-H is a growth suppressor protein underexpressed in hepatocellular carcinoma. Nucleic Acids Res. 2005;33:1859-1873.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 86]  [Cited by in RCA: 83]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
24.  Rahman MA, Kyriazanos ID, Ono T, Yamanoi A, Kohno H, Tsuchiya M, Nagasue N. Impact of PTEN expression on the outcome of hepatitis C virus-positive cirrhotic hepatocellular carcinoma patients: possible relationship with COX II and inducible nitric oxide synthase. Int J Cancer. 2002;100:152-157.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 48]  [Cited by in RCA: 42]  [Article Influence: 1.8]  [Reference Citation Analysis (0)]
25.  Chung CY, Yeh KT, Hsu NC, Chang JH, Lin JT, Horng HC, Chang CS. Expression of c-kit protooncogene in human hepatocellular carcinoma. Cancer Lett. 2005;217:231-236.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 25]  [Cited by in RCA: 24]  [Article Influence: 1.1]  [Reference Citation Analysis (0)]
26.  Dagli ML, Yamasaki H, Krutovskikh V, Omori Y. Delayed liver regeneration and increased susceptibility to chemical hepatocarcinogenesis in transgenic mice expressing a dominant-negative mutant of connexin32 only in the liver. Carcinogenesis. 2004;25:483-492.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 50]  [Cited by in RCA: 45]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
27.  Sasaki M, Tsuneyama K, Nakanuma Y. Aberrant expression of trefoil factor family 1 in biliary epithelium in hepatolithiasis and cholangiocarcinoma. Lab Invest. 2003;83:1403-1413.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 35]  [Cited by in RCA: 35]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
28.  Hayashi J, Kajino K, Umeda T, Takano S, Arakawa Y, Kudo M, Hino O. Somatic mutation and SNP in the promoter of dbpA and human hepatocarcinogenesis. Int J Oncol. 2002;21:847-850.  [PubMed]  [DOI]
29.  Luk JM, Lam CT, Siu AF, Lam BY, Ng IO, Hu MY, Che CM, Fan ST. Proteomic profiling of hepatocellular carcinoma in Chinese cohort reveals heat-shock proteins (Hsp27, Hsp70, GRP78) up-regulation and their associated prognostic values. Proteomics. 2006;6:1049-1057.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 155]  [Cited by in RCA: 146]  [Article Influence: 7.3]  [Reference Citation Analysis (1)]
30.  Cheung ST, Wong SY, Leung KL, Chen X, So S, Ng IO, Fan ST. Granulin-epithelin precursor overexpression promotes growth and invasion of hepatocellular carcinoma. Clin Cancer Res. 2004;10:7629-7636.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 107]  [Cited by in RCA: 105]  [Article Influence: 4.8]  [Reference Citation Analysis (0)]
31.  Sugano Y, Matsuzaki K, Tahashi Y, Furukawa F, Mori S, Yamagata H, Yoshida K, Matsushita M, Nishizawa M, Fujisawa J. Distortion of autocrine transforming growth factor beta signal accelerates malignant potential by enhancing cell growth as well as PAI-1 and VEGF production in human hepatocellular carcinoma cells. Oncogene. 2003;22:2309-2321.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 33]  [Cited by in RCA: 31]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
32.  Sieghart W, Losert D, Strommer S, Cejka D, Schmid K, Rasoul-Rockenschaub S, Bodingbauer M, Crevenna R, Monia BP, Peck-Radosavljevic M. Mcl-1 overexpression in hepatocellular carcinoma: a potential target for antisense therapy. J Hepatol. 2006;44:151-157.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 191]  [Cited by in RCA: 193]  [Article Influence: 9.7]  [Reference Citation Analysis (5)]
33.  Poole BD, Karetnyi YV, Naides SJ. Parvovirus B19-induced apoptosis of hepatocytes. J Virol. 2004;78:7775-7783.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 65]  [Cited by in RCA: 61]  [Article Influence: 2.8]  [Reference Citation Analysis (0)]
34.  Zhou X, Thorgeirsson SS, Popescu NC. Restoration of DLC-1 gene expression induces apoptosis and inhibits both cell growth and tumorigenicity in human hepatocellular carcinoma cells. Oncogene. 2004;23:1308-1313.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 116]  [Cited by in RCA: 115]  [Article Influence: 5.2]  [Reference Citation Analysis (0)]
35.  Damdinsuren B, Nagano H, Kondo M, Yamamoto H, Hiraoka N, Yamamoto T, Marubashi S, Miyamoto A, Umeshita K, Dono K. Expression of Id proteins in human hepatocellular carcinoma: relevance to tumor dedifferentiation. Int J Oncol. 2005;26:319-327.  [PubMed]  [DOI]
36.  Nagano H, Noguchi T, Inagaki K, Yoon S, Matozaki T, Itoh H, Kasuga M, Hayashi Y. Downregulation of stomach cancer-associated protein tyrosine phosphatase-1 (SAP-1) in advanced human hepatocellular carcinoma. Oncogene. 2003;22:4656-4663.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 25]  [Cited by in RCA: 22]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
37.  Nejjari M, Hafdi Z, Gouysse G, Fiorentino M, Béatrix O, Dumortier J, Pourreyron C, Barozzi C, D'errico A, Grigioni WF. Expression, regulation, and function of alpha V integrins in hepatocellular carcinoma: an in vivo and in vitro study. Hepatology. 2002;36:418-426.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 56]  [Cited by in RCA: 48]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
38.  Fu BH, Wu ZZ, Dong C. Integrin beta1 mediates hepatocellular carcinoma cells chemotaxis to laminin. Hepatobiliary Pancreat Dis Int. 2004;3:548-551.  [PubMed]  [DOI]
39.  Zhao L, Qin LX, Ye QH, Zhu XQ, Zhang H, Wu X, Chen J, Liu YK, Tang ZY. KIAA0008 gene is associated with invasive phenotype of human hepatocellular carcinoma--a functional analysis. J Cancer Res Clin Oncol. 2004;130:719-727.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 13]  [Cited by in RCA: 13]  [Article Influence: 0.6]  [Reference Citation Analysis (0)]
40.  Zhang BH, Chen H, Yao XP, Cong WM, Wu MC. E-selectin and its ligand-sLeX in the metastasis of hepatocellular carcinoma. Hepatobiliary Pancreat Dis Int. 2002;1:80-82.  [PubMed]  [DOI]
41.  Hamatsu T, Rikimaru T, Yamashita Y, Aishima S, Tanaka S, Shirabe K, Shimada M, Toh Y, Sugimachi K. The role of MTA1 gene expression in human hepatocellular carcinoma. Oncol Rep. 2003;10:599-604.  [PubMed]  [DOI]
42.  Cervello M, Giannitrapani L, Labbozzetta M, Notarbartolo M, D'Alessandro N, Lampiasi N, Azzolina A, Montalto G. Expression of WISPs and of their novel alternative variants in human hepatocellular carcinoma cells. Ann N Y Acad Sci. 2004;1028:432-439.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 38]  [Cited by in RCA: 41]  [Article Influence: 1.9]  [Reference Citation Analysis (0)]
43.  Kondoh N, Hada A, Ryo A, Shuda M, Arai M, Matsubara O, Kimura F, Wakatsuki T, Yamamoto M. Activation of Galectin-1 gene in human hepatocellular carcinoma involves methylation-sensitive complex formations at the transcriptional upstream and downstream elements. Int J Oncol. 2003;23:1575-1583.  [PubMed]  [DOI]
44.  Hira E, Ono T, Dhar DK, El-Assal ON, Hishikawa Y, Yamanoi A, Nagasue N. Overexpression of macrophage migration inhibitory factor induces angiogenesis and deteriorates prognosis after radical resection for hepatocellular carcinoma. Cancer. 2005;103:588-598.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 79]  [Cited by in RCA: 80]  [Article Influence: 3.8]  [Reference Citation Analysis (0)]
45.  Sasaki Y, Yamamura H, Kawakami Y, Yamada T, Hiratsuka M, Kameyama M, Ohigashi H, Ishikawa O, Imaoka S, Ishiguro S. Expression of smooth muscle calponin in tumor vessels of human hepatocellular carcinoma and its possible association with prognosis. Cancer. 2002;94:1777-1786.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 22]  [Cited by in RCA: 23]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
46.  Hu TH, Huang CC, Wu CL, Lin PR, Liu SY, Lin JW, Chuang JH, Tai MH. Increased endostatin/collagen XVIII expression correlates with elevated VEGF level and poor prognosis in hepatocellular carcinoma. Mod Pathol. 2005;18:663-672.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 42]  [Cited by in RCA: 38]  [Article Influence: 1.8]  [Reference Citation Analysis (0)]
47.  Wang XQ, Luk JM, Leung PP, Wong BW, Stanbridge EJ, Fan ST. Alternative mRNA splicing of liver intestine-cadherin in hepatocellular carcinoma. Clin Cancer Res. 2005;11:483-489.  [PubMed]  [DOI]
48.  Wong N, Chan A, Lee SW, Lam E, To KF, Lai PB, Li XN, Liew CT, Johnson PJ. Positional mapping for amplified DNA sequences on 1q21-q22 in hepatocellular carcinoma indicates candidate genes over-expression. J Hepatol. 2003;38:298-306.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 73]  [Cited by in RCA: 73]  [Article Influence: 3.2]  [Reference Citation Analysis (1)]
49.  Endo K, Yoon BI, Pairojkul C, Demetris AJ, Sirica AE. ERBB-2 overexpression and cyclooxygenase-2 up-regulation in human cholangiocarcinoma and risk conditions. Hepatology. 2002;36:439-450.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 153]  [Cited by in RCA: 150]  [Article Influence: 6.3]  [Reference Citation Analysis (1)]
50.  Cui J, Zhou X, Liu Y, Tang Z, Romeih M. Wnt signaling in hepatocellular carcinoma: analysis of mutation and expression of beta-catenin, T-cell factor-4 and glycogen synthase kinase 3-beta genes. J Gastroenterol Hepatol. 2003;18:280-287.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 85]  [Cited by in RCA: 82]  [Article Influence: 3.6]  [Reference Citation Analysis (3)]
51.  Yau TO, Chan CY, Chan KL, Lee MF, Wong CM, Fan ST, Ng IO. HDPR1, a novel inhibitor of the WNT/beta-catenin signaling, is frequently downregulated in hepatocellular carcinoma: involvement of methylation-mediated gene silencing. Oncogene. 2005;24:1607-1614.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 66]  [Cited by in RCA: 62]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
52.  Ikeguchi M, Hirooka Y. Expression of c-myc mRNA in hepatocellular carcinomas, noncancerous livers, and normal livers. Pathobiology. 2004;71:281-286.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 11]  [Article Influence: 0.5]  [Reference Citation Analysis (0)]
53.  Fong CW, Chua MS, McKie AB, Ling SH, Mason V, Li R, Yusoff P, Lo TL, Leung HY, So SK. Sprouty 2, an inhibitor of mitogen-activated protein kinase signaling, is down-regulated in hepatocellular carcinoma. Cancer Res. 2006;66:2048-2058.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 126]  [Cited by in RCA: 125]  [Article Influence: 6.3]  [Reference Citation Analysis (0)]
54.  Shuda M, Kondoh N, Imazeki N, Tanaka K, Okada T, Mori K, Hada A, Arai M, Wakatsuki T, Matsubara O. Activation of the ATF6, XBP1 and grp78 genes in human hepatocellular carcinoma: a possible involvement of the ER stress pathway in hepatocarcinogenesis. J Hepatol. 2003;38:605-614.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 409]  [Cited by in RCA: 389]  [Article Influence: 16.9]  [Reference Citation Analysis (0)]
55.  Qiu W, David D, Zhou B, Chu PG, Zhang B, Wu M, Xiao J, Han T, Zhu Z, Wang T. Down-regulation of growth arrest DNA damage-inducible gene 45beta expression is associated with human hepatocellular carcinoma. Am J Pathol. 2003;162:1961-1974.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 59]  [Cited by in RCA: 61]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
56.  Yan J, Yu Y, Wang N, Chang Y, Ying H, Liu W, He J, Li S, Jiang W, Li Y. LFIRE-1/HFREP-1, a liver-specific gene, is frequently downregulated and has growth suppressor activity in hepatocellular carcinoma. Oncogene. 2004;23:1939-1949.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 53]  [Cited by in RCA: 48]  [Article Influence: 2.2]  [Reference Citation Analysis (3)]
57.  Fukai K, Yokosuka O, Chiba T, Hirasawa Y, Tada M, Imazeki F, Kataoka H, Saisho H. Hepatocyte growth factor activator inhibitor 2/placental bikunin (HAI-2/PB) gene is frequently hypermethylated in human hepatocellular carcinoma. Cancer Res. 2003;63:8674-8679.  [PubMed]  [DOI]
58.  Park DY, Lee CH, Sol MY, Suh KS, Yoon SY, Kim JW. Expression and localization of the transforming growth factor-beta type I receptor and Smads in preneoplastic lesions during chemical hepatocarcinogenesis in rats. J Korean Med Sci. 2003;18:510-519.  [PubMed]  [DOI]
59.  Fu Y, Deng W, Kawarada Y, Kawagoe M, Ma YZ, Li X, Guo N, Kameda T, Terada K, Sugiyama T. Mutation and expression of the p53 gene during chemical hepatocarcinogenesis in F344 rats. Biochim Biophys Acta. 2003;1628:40-49.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 6]  [Article Influence: 0.3]  [Reference Citation Analysis (0)]
60.  Detjen KM, Murphy D, Welzel M, Farwig K, Wiedenmann B, Rosewicz S. Downregulation of p21(waf/cip-1) mediates apoptosis of human hepatocellular carcinoma cells in response to interferon-gamma. Exp Cell Res. 2003;282:78-89.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 30]  [Cited by in RCA: 29]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
61.  Soung YH, Lee JW, Kim SY, Sung YJ, Park WS, Nam SW, Kim SH, Lee JY, Yoo NJ, Lee SH. Caspase-8 gene is frequently inactivated by the frameshift somatic mutation 1225_1226delTG in hepatocellular carcinomas. Oncogene. 2005;24:141-147.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 95]  [Cited by in RCA: 84]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
62.  Pontisso P, Calabrese F, Benvegnù L, Lise M, Belluco C, Ruvoletto MG, Marino M, Valente M, Nitti D, Gatta A. Overexpression of squamous cell carcinoma antigen variants in hepatocellular carcinoma. Br J Cancer. 2004;90:833-837.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 104]  [Cited by in RCA: 99]  [Article Influence: 4.5]  [Reference Citation Analysis (0)]
63.  Sawai Y, Tamura S, Fukui K, Ito N, Imanaka K, Saeki A, Sakuda S, Kiso S, Matsuzawa Y. Expression of ephrin-B1 in hepatocellular carcinoma: possible involvement in neovascularization. J Hepatol. 2003;39:991-996.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 47]  [Cited by in RCA: 38]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
64.  Khoury T, Chadha K, Javle M, Donohue K, Levea C, Iyer R, Okada H, Nagase H, Tan D. Expression of intestinal trefoil factor (TFF-3) in hepatocellular carcinoma. Int J Gastrointest Cancer. 2005;35:171-177.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 19]  [Cited by in RCA: 21]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
65.  Tang W, Miki K, Kokudo N, Sugawara Y, Imamura H, Minagawa M, Yuan LW, Ohnishi S, Makuuchi M. Des-gamma-carboxy prothrombin in cancer and non-cancer liver tissue of patients with hepatocellular carcinoma. Int J Oncol. 2003;22:969-975.  [PubMed]  [DOI]
66.  Chuma M, Saeki N, Yamamoto Y, Ohta T, Asaka M, Hirohashi S, Sakamoto M. Expression profiling in hepatocellular carcinoma with intrahepatic metastasis: identification of high-mobility group I(Y) protein as a molecular marker of hepatocellular carcinoma metastasis. Keio J Med. 2004;53:90-97.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 20]  [Cited by in RCA: 23]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
67.  Chuma M, Sakamoto M, Yasuda J, Fujii G, Nakanishi K, Tsuchiya A, Ohta T, Asaka M, Hirohashi S. Overexpression of cortactin is involved in motility and metastasis of hepatocellular carcinoma. J Hepatol. 2004;41:629-636.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 96]  [Cited by in RCA: 90]  [Article Influence: 4.1]  [Reference Citation Analysis (0)]
68.  Boccaccio C, Sabatino G, Medico E, Girolami F, Follenzi A, Reato G, Sottile A, Naldini L, Comoglio PM. The MET oncogene drives a genetic programme linking cancer to haemostasis. Nature. 2005;434:396-400.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 194]  [Cited by in RCA: 168]  [Article Influence: 8.0]  [Reference Citation Analysis (0)]
69.  Kasper G, Vogel A, Klaman I, Gröne J, Petersen I, Weber B, Castaños-Vélez E, Staub E, Mennerich D. The human LAPTM4b transcript is upregulated in various types of solid tumours and seems to play a dual functional role during tumour progression. Cancer Lett. 2005;224:93-103.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 77]  [Cited by in RCA: 79]  [Article Influence: 3.8]  [Reference Citation Analysis (0)]
70.  Tsujita E, Taketomi A, Gion T, Kuroda Y, Endo K, Watanabe A, Nakashima H, Aishima S, Kohnoe S, Maehara Y. Suppressed MKP-1 is an independent predictor of outcome in patients with hepatocellular carcinoma. Oncology. 2005;69:342-347.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 45]  [Cited by in RCA: 40]  [Article Influence: 1.9]  [Reference Citation Analysis (0)]
71.  Falvella FS, Pascale RM, Gariboldi M, Manenti G, De Miglio MR, Simile MM, Dragani TA, Feo F. Stearoyl-CoA desaturase 1 (Scd1) gene overexpression is associated with genetic predisposition to hepatocarcinogenesis in mice and rats. Carcinogenesis. 2002;23:1933-1936.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 75]  [Cited by in RCA: 69]  [Article Influence: 2.9]  [Reference Citation Analysis (0)]
72.  Tokusashi Y, Asai K, Tamakawa S, Yamamoto M, Yoshie M, Yaginuma Y, Miyokawa N, Aoki T, Kino S, Kasai S. Expression of NGF in hepatocellular carcinoma cells with its receptors in non-tumor cell components. Int J Cancer. 2005;114:39-45.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 29]  [Cited by in RCA: 29]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
73.  Yoshida T, Ogata H, Kamio M, Joo A, Shiraishi H, Tokunaga Y, Sata M, Nagai H, Yoshimura A. SOCS1 is a suppressor of liver fibrosis and hepatitis-induced carcinogenesis. J Exp Med. 2004;199:1701-1707.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 151]  [Cited by in RCA: 148]  [Article Influence: 6.7]  [Reference Citation Analysis (0)]
74.  Niwa Y, Kanda H, Shikauchi Y, Saiura A, Matsubara K, Kitagawa T, Yamamoto J, Kubo T, Yoshikawa H. Methylation silencing of SOCS-3 promotes cell growth and migration by enhancing JAK/STAT and FAK signalings in human hepatocellular carcinoma. Oncogene. 2005;24:6406-6417.  [PubMed]  [DOI]
75.  Sun L, Gong R, Wan B, Huang X, Wu C, Zhang X, Zhao S, Yu L. GADD45gamma, down-regulated in 65% hepatocellular carcinoma (HCC) from 23 chinese patients, inhibits cell growth and induces cell cycle G2/M arrest for hepatoma Hep-G2 cell lines. Mol Biol Rep. 2003;30:249-253.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 25]  [Cited by in RCA: 27]  [Article Influence: 1.2]  [Reference Citation Analysis (0)]
76.  Mori T, Nomoto S, Koshikawa K, Fujii T, Sakai M, Nishikawa Y, Inoue S, Takeda S, Kaneko T, Nakao A. Decreased expression and frequent allelic inactivation of the RUNX3 gene at 1p36 in human hepatocellular carcinoma. Liver Int. 2005;25:380-388.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 56]  [Cited by in RCA: 62]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
77.  Lazarevich NL, Cheremnova OA, Varga EV, Ovchinnikov DA, Kudrjavtseva EI, Morozova OV, Fleishman DI, Engelhardt NV, Duncan SA. Progression of HCC in mice is associated with a downregulation in the expression of hepatocyte nuclear factors. Hepatology. 2004;39:1038-1047.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 184]  [Cited by in RCA: 178]  [Article Influence: 8.1]  [Reference Citation Analysis (0)]
78.  Oh BK, Kim YJ, Park C, Park YN. Up-regulation of telomere-binding proteins, TRF1, TRF2, and TIN2 is related to telomere shortening during human multistep hepatocarcinogenesis. Am J Pathol. 2005;166:73-80.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 116]  [Cited by in RCA: 107]  [Article Influence: 5.1]  [Reference Citation Analysis (0)]
79.  Salvi A, Arici B, De Petro G, Barlati S. Small interfering RNA urokinase silencing inhibits invasion and migration of human hepatocellular carcinoma cells. Mol Cancer Ther. 2004;3:671-678.  [PubMed]  [DOI]
80.  Onaga M, Ido A, Hasuike S, Uto H, Moriuchi A, Nagata K, Hori T, Hayash K, Tsubouchi H. Osteoactivin expressed during cirrhosis development in rats fed a choline-deficient, L-amino acid-defined diet, accelerates motility of hepatoma cells. J Hepatol. 2003;39:779-785.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 74]  [Cited by in RCA: 72]  [Article Influence: 3.1]  [Reference Citation Analysis (0)]
81.  Cheung ST, Leung KL, Ip YC, Chen X, Fong DY, Ng IO, Fan ST, So S. Claudin-10 expression level is associated with recurrence of primary hepatocellular carcinoma. Clin Cancer Res. 2005;11:551-556.  [PubMed]  [DOI]
82.  Lai JP, Chien JR, Moser DR, Staub JK, Aderca I, Montoya DP, Matthews TA, Nagorney DM, Cunningham JM, Smith DI. hSulf1 Sulfatase promotes apoptosis of hepatocellular cancer cells by decreasing heparin-binding growth factor signaling. Gastroenterology. 2004;126:231-248.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 126]  [Cited by in RCA: 122]  [Article Influence: 5.5]  [Reference Citation Analysis (0)]
Footnotes

S- Editor Liu Y L- Editor Alpini GD E- Editor Ma WH

Write to the Help Desk