BPG is committed to discovery and dissemination of knowledge
Rapid Communication Open Access
©2006 Baishideng Publishing Group Co., Limited. All rights reserved.
World J Gastroenterol. Jan 21, 2006; 12(3): 468-472
Published online Jan 21, 2006. doi: 10.3748/wjg.v12.i3.468
Helicobacter pylori infection in the pharynx of patients with chronic pharyngitis detected with TDI-FP and modified Giemsa stain
Jiang-Ping Zhang, Zhen-Hui Peng, Xiang-Hong Zhang. Qing Yin Zheng, Department of Otolaryngology, Second Hospital of Xi’an Jiaotong University, Xi’an 710004, Shaanxi Province, China
Ju Zhang, Institute of Genic Diagnosis, Fourth Military Medical University, Xi’an 710032, Shaanxi Province, China
Qing Yin Zheng, The Jackson Laboratory, 600 Main Street, Bar Harbor, ME 04609, United States
Co-correspondence: Jiang-Ping Zhang
Supported by a grant from the Bureau of Health in Shaanxi Province, No. 2002 02D24 and grants No. NSFC30440080; No. NIDCD R21 DC005846
Correspondence to: Dr. Qing Yin Zheng, The Jackson Laboratory, 600 Main Street, Bar Harbor, ME 04609, United States. qyz@jax.org
Telephone: +1-207-288-6609 Fax: +1-207-288-6149
Received: March 10, 2005
Revised: June 28, 2005
Accepted: October 12, 2005
Published online: January 21, 2006

Abstract

AIM: To detect whether there is Helicobacter pylori (H pylori) colonization in the pharynx mucous membrane of healthy people and whether chronic pharyngitis is related to H pylori infection.

METHODS: Fifty cases of chronic pharyngitis refractory over three months were prospectively studied from March 2004 to August 2004 in the otolaryngology outpatient department of the Second Hospital of Xi’an Jiaotong University. Template-directed dye-terminator incorporated with fluorescence polarization detection (TDI-FP) and modified Giemsa stain were used to examine pharynx mucous membrane tissue for H pylori colonization in the patients with chronic pharyngitis and the healthy people as a control group.

RESULTS: In the control group, no people were detected to have H pylori in the pharynx. In contrast, in 50 cases with chronic pharyngitis, 19 (38.0%) cases were H pylori positive with a TDI-FP assay and 4 (8%) cases were TDI-FP positive with Giemsa staining in the pharynx. Sixteen of the 50 pharyngitis cases had stomach ailment history, 11 cases (68.8%) of these 16 patients were determined to be H pylori positive in the pharynx with the TDI-FP assay. χ2 test showed that this infection rate was remarkably higher (P = 0.0007) than that in the cases without stomach ailment history. Giemsa staining showed that 3 cases (18.8%) of the patients with stomach ailment history were infected with H pylori in the pharynx, which was remarkably higher (P  = 0.042) than that in the patients without stomach ailment history (1 case, which was 2.9%).

CONCLUSION: H pylori may not be detected in the pharynx of healthy people. Chronic pharyngitis may be related to H pylori infection. The infection rate with H pylori in the pharynx is higher in patients with stomach ailment histories than in patients without stomach ailment histories, suggesting that chronic pharyngitis may be related to stomach ailment history.

Key Words: Chronic pharyngitis; H pylori; Modified Giemsa stain



INTRODUCTION

Chronic pharyngitis is a common disease in the otolaryngology clinic. Pharyngitis, bronchitis, and pneumonia represent the most common respiratory tract infections. Upper respiratory tract infections are common and important. These include sinusitis, otitis media, and pharyngitis/tonsillitis. Many patients visiting an office-based physician report “sore throat, foreign-body sensation in the throat” as their primary reason for the visit[1]. Acute pharyngitis may be caused by a wide variety of microbial agents, but some of the most common and potentially dangerous microorganisms are group A beta-hemolytic streptococci (GABHS). For example, streptococcal pharyngitis is responsible for about 5% to 17% of sore throats in adults. However, the causative microorganisms in many cases remain unclear[2]. An important risk factor for chronic pharyngitis is gastroesophageal reflux disease (GERD). GERD is a common disorder in the Western population and is also common in Xi’an’s adult population. The etiology and pathogenesis of GERD are probably associated with other conditions that are also risk factors for chronic pharyngitis, including functional dyspepsia (FD), irritable bowel syndrome (IBS), and some respiratory and laryngopharyngeal diseases[3].

The Gram-negative bacterium Helicobacter pylori (H pylori) is associated with severe gastric pathologies, including peptic ulcers, chronic active gastritis and gastric cancer. This microorganism is able to invade and colonize in the human stomach, gastric juice, saliva, and faeces of patients[4-6]. Moreover, as relates to the current study, investigations using the CLO (Campylobacter-like organism) test and PCR showed that there was a high rate of H pylori colonization in tonsil and adenoid tissues[7,8], however, another investigation indicated the opposite result [9]. Therefore, we sought to detect whether there was H pylori colonization in the pharynx in healthy people, as compared to patients suffering from chronic pharyngitis. We used two methods to detect H pylori infection in the pharynx: template-directed dye-terminator incorporated with fluorescence polarization detection (TDI-FP) and modified Giemsa stain. From this study, it can be determined more definitively whether there is a relationship between H pylori infection of the pharynx and chronic pharyngitis; moreover, it can be determined if a history of certain gastric diseases may contribute to this infection.

MATERIALS AND METHODS
Patients

Two groups were studied, a group with chronic pharyngitis and a control group without chronic pharyngitis. The group with chronic pharyngitis consisted of 50 cases of chronic pharyngitis refractory over three months that were studied from March, 2004 to August, 2004 in the otolaryngology outpatient department. Among them, 32 cases were females and 18 cases were males, with ages ranging from 23 to 52 years old. The shortest disease history was 3 mo and the longest was 8 years. Major symptoms included foreign body sensation, dry sensation, angina in the pharynx, nausea, cough and belching. Clinical examination showed congestion in the pharynx mucosa, lymph follicle hyperplasia, and slightly swollen tonsils. Of these 50 cases, there were 34 cases with no specific stomach ailment history and 16 cases with gastric ulcers or chronic active gastritis. There were 20 cases in the control group. Of these, 12 cases were females and 8 cases were males. Ages ranged from 20-51 years old. The people in the control group had no specific pharyngitis or stomach ailment history, such as gastric ulcer or chronic active gastritis. In addition, all the people in the above two groups (1) had no other system diseases; (2) had no antibiotics treatment 10 d before examination; and (3) had no clear history of metronidazole, amoxicillin or tetracycline treatment. To collect tissue from the pharynx of each patient, the surface of the pharynx mucous membrane was sprayed with 20 g/L amethocaine for anaesthesia. Epithelial tissue in the pharynx was then collected with a sterilized curette. The protocol was approved by the Institutional Human Subject Committee at Xi’an Jiaotong University.

Methods

The biopsied epithelial tissue from the pharynx of each patient was routinely fixed in 4 g/L formaldehyde and embedded in paraffin wax. Histological sections were stained with routine modified Giemsa.

Fluorescence Polarization-Capable Instrument-Victor, AmpliTaq DNA Polymerase, shrimp alkaline phosphatase, E. coli exonuclease I, mixtures of TAMRA-ddTTP and RP110-ddGTP were purchased from PerkinElmer. The pGEM-T-Easy Vector System TA Cloning Kit was purchased from Promega. The ABI 377 and BigDye Terminator Cycle Sequencing Kit were purchased from Applied Biosystem(s). All reactions were run and read in 96-well black-skirted plates purchased from MJ Research. The specific probes and terminators of H pylori were designed by DNA Star based on a specific target sequence. All probes were synthesized by Sbsbio (Beijing, China).

Scrapes or biopsies were collected and washed into 5 mL PBS (pH 7.2). In each case, the cell suspension was centrifuged for 5 min at 10 000 r/min. The cell pellet was re-suspended and mixed in 1.5 mL TE buffer (200 mg/L proteinase K, 10 mmol/L Tris, 0.1 mmol/L EDTA, 1 g/L SDS, 3 g/L Triton X-100) at 37 oC for 12 h. The suspension was incubated at 95 oC for 10 min to inactivate proteinase K, and then it was centrifuged for 5 min at 10 000 r/min. The supernatant DNA was used as a template for PCR.

Amplification of H pylori DNA by using a conservative primer pair

For extensive detection of H pylori DNA, each sample DNA was first amplified in a 25 μL reaction mixture containing 1 μL of DNA extract, 2 μL of 6.25 pmol/L common conservative primer pair (P1, 5’ tgcccgcttccactaaccccacta 3’; P2, 5’ gtcagccactttgcccacttctacag 3’, H pylori urease B (ureB) gene (gene bank accession number AY295085), 10×PCR reaction buffer (10 mmol/L Tris-HCl, 50 mmol/L KCl), 2.5 μL of 2.5 mmol/L dNTP, 1.5 μL of 25 mmol/L MgCl2, and 2.5 μL of 0.25 U AmpliTaq DNA Polymerase. The mixture was denatured initially for 5 min at 94 oC, followed by 30 cycles of amplification in a PCR processor. Each cycle included a denaturing step of 94 oC for 1 min, an annealing step of 45 oC for 1 min and a chain elongation step of 72 oC for 1.5 min. The final elongation step was then prolonged for another 5 min. The size of all H pylori genotyping PCR products was predicted to be 413bp according to gene bank accession number AY295085. Sample containing other plasmid DNA was the negative control.

All PCR products were analyzed using a template directed dye-terminator incorporation assay (TDI) with fluorescence polarization (FP). In order to degrade excess dNTP and common conservative primers in the PCR product, 1μL of PCR product, 16.67 nkat of shrimp alkaline phosphatase, 1U of E. coli exonuclease I in 1 μL of shrimp alkaline phosphatase buffer (0.5 mol/L Tris-HCl, pH8.5, 50 mmol/L MgCl2), and 8 μL of distilled water were mixed and incubated at 37 oC for 60 min before enzymes were heat-inactivated at 80 oC for 15 min. Thirteen microliters of TDI-FP mixture containing 10× reaction buffer, TAMRA-ddTTP, RP110-ddGTP, H pylori probes and 7 μL of the enzymatically treated PCR product were mixed and denatured at 95 oC for 2 min, followed by 25 cycles of 95 oC for 15 s and 50 oC for 30 s. At the end of the cycles, the mixture was held at room temperature. H pylori genes were acquired by reading FP (mp) at wavelengths of 535 nm and 595 nm, and analyzed by Fluorescence Polarization-Capable Instrument-Victor.

Statistical analysis

All the data were analyzed by the χ2 test.

RESULTS

H pylori infections in the pharynx of the people in the control group and the patients suffering from chronic pharyngitis were examined with TDI-FP and modified Giemsa stain. In the control group, analysis with TDI-FP showed that none of the 20 cases was infected with H pylori in the pharynx. The examination using modified Giemsa stain revealed that no cases were infected with H pylori in the pharynx.

Regarding the 50 cases of the patients who were suffering from chronic pharyngitis, 19 cases (38%) were determined using TDI-FP to be infected with H pylori in the pharynx. When the modified Giemsa stain procedure was used, 4 cases (8.0%) of patients were determined to be infected with H pylori in the pharynx. In the 16 pharyngitis cases with stomach ailment history, 11 cases (68.8%) were determined using TDI-FP to be infected with H pylori in the pharynx, which was remarkably higher (P ≤ 0.01) than that in the cases without stomach ailment history (8 cases, 23.5% ) as determined by the Statistical χ2 test. From using the modified Giemsa stain method, 3 cases (18.8%) of patients with a stomach ailment history were determined to be infected with H pylori in the pharynx, which was remarkably higher ( P10 ≤ 0.01) than that in patients without a stomach ailment history (1 case, 2.9%), as determined by the statistical χ2 test (Table 1). This showed the following: (1) that H pylori is not detected in the pharynx of healthy people; (2) that chronic pharyngitis is often related to H pylori infection; and (3) that a stomach ailment history is associated with a higher rate of H pylori infection of the pharynx.

Table 1 H pylori infection in the pharynx of patients with chronic pharyngitis.
GroupCaseTDI-FP(%)Giemsa(%)
Chronic pharyngitis5019 (38.0)a4 (8.0)
With stomach ailment history1611 (68.8)b3 (18.8)b
Without stomach ailment history348 (23.5)1 (2.9)
Normal (Control)2000
DISCUSSION

We used two methods to detect H pylori infection, template-directed dye-terminator incorporation with fluorescence polarization (TDI-FP), and modified Giemsa stain. TDI-FP is a single base extension technique in which an oligonucleotide probe anneals to a polymerase chain reaction (PCR)-amplified product adjacent to a single nucleotide polymorphism (SNP) of interest[3,10]. In the presence of DNA polymerase and fluorescently labeled dideoxyribonucleoside triphosphates (ddNTPs), the probe is extended by a single base dictated by the polymorphic site in the target sequence. Fluorescence polarization, the property that fluorescent molecules emit polarized fluorescent light when excited by plane polarized light, is used to identify incorporated ddNTP, and to assign a genotype[10]. With this design, the PCR primers will not interfere with the primer extension step of the assay. This method is simple, rapid, sensitive, specific and could also be used for detecting pathogen DNA in the clinic[11,12]. The modified Giemsa stain is very straightforward, inexpensive, and takes about five minutes to perform, excluding the time in solution, and rarely requires repeat stains[13].

In the current study, we examined for H pylori infection in the pharynx with TDI-FP and the modified Giemsa stain methods. These two methods are rapid, sensitive, specific, easily reproducible and easy to perform technically. The secretion in the pharynx in our study was washed out by water from the epithelial tissue in the checked pharynx before examination so that the results were not affected by gastric juice and saliva.

Sore throat is one of the most common reasons for visits to family physicians. While most patients with sore throat have an infectious cause (such as pharyngitis), fewer than 20 percent have a clear indication for antibiotic therapy (i.e., group A beta-hemolytic streptococcal infection). Useful, well-validated clinical decision rules are available to help family physicians care for patients who present with pharyngitis[14]. Because of recent improvements in rapid streptococcal antigen tests, throat culture can be reserved for patients whose symptoms do not improve over time or who do not respond to antibiotics. Pharyngitis and the common cold are among the most frequent diseases. Two thirds of the patients consulting for respiratory infection received antibiotic treatment, and antibiotics confer relative benefits in the treatment of sore throat[16]. Pharyngitis may be caused by a wide variety of microbial agents. Burkholderia cepacia is a Gram-negative bacillus that is widely distributed in nature; pharyngitis due to Burkholderia cepacia was reported for person-to-person transmission[17]. The main aetiological agents reportedly causing acute pharyngitis were adenovirus, respiratory syncytial virus (RSV), Mycoplasma pneumoniae, Streptococcus pyogenes and Chlamydia pneumoniae. M. pneumoniae was the agent found most frequently as a single pathogen. A history of recurrent pharyngitis, having older siblings and a negative outcome were significantly more common among patients with acute M. pneumoniae infection than among those with infections due to other pathogens, or healthy controls. That study demonstrates that: (1) adenovirus and RSV have a prominent role in acute pharyngitis; (2) S. pyogenes is found frequently, but it is not possible to distinguish simple carriers from patients with a true infection; and (3) M. pneumoniae appears to be able to cause acute pharyngitis[18]. In our daily work, we use antibiotics to treat pharyngitis and sore throat and find antibiotics are effective, although we are not clear about the mechanism of the treatment.

H pylori is one of the world’s most widespread microorganisms. The abrupt increase of H pylori during high school may result from a marked increase of interpersonal social activities[19]. Its acquisition in humans remains poorly understood, however, epidemiological studies have identified drinking water as a reservoir for the bacterium[20]. H pylori has been associated with the development of gastritis, peptic ulcers and gastric cancer. Although H pylori infects up to more than half of the world’s population, to date the precise modes of transmission have not been fully understood[13]. H pylori has been investigated in several other organ systems and localizations besides the gastrointestinal cavity, such as the oral cavity. For example, in one study, it was found that the majority of patients with oral diseases have possible H pylori colonization in dental plaque; while about two-thirds have H pylori associated chronic active gastritis. The oral cavity may be the first place for colonization by H pylori, and then the infection involves the gastric mucosa[21]. Oral hygiene (the frequency of dental visits and teeth cleaning) did not have a significant influence on the presence of H pylori in dental plaque. Other investigators supported the hypothesis that H pylori infection begins in the oral cavity by concluding that dental plaque is the reservoir of H pylori with no relationship to gastric infection[22]. In our study, the pharynx may be a place for H pylori colonization, but the number of H pylori was so few that the modified Giemsa stain was not very useful. Therefore, we made an amplification of H pylori DNA by using a conservative primer pair, then detected the H pylori colonization using TDI-FP and acquired a good result.

Other investigators have studied the localization of H pylori as well. Akbayir et al[23] demonstrated that H pylori was not present in laryngeal squamous cell carcinoma tissue or in benign lesions. They could not find any evidence indicating that H pylori played a role at the tissue level in the pathogenesis of laryngeal carcinoma. Their results may indicate that H pylori does not colonize in either adenoid or tonsils and that these tissues do not constitute a reservoir for H pylori infection. On the contrary, Cirak et al[7] detected H pylori and its CagA gene in tonsil and adenoid tissues by PCR. These authors found: 7 of 23 (30%) patients to be positive for H pylori DNA, 5 (71%) of whom also possessed the CagA gene. In another study, specimens from 208 dyspeptic patients were collected from saliva, supra- and subgingival dental plaque, tongue scrapings, and oropharyngeal swabs. H pylori was detected from multiple sites (dental plaque, gastric juice, gastric biopsy, duodenal aspirate, and the oropharynx[26]). As in our study, the authors used more than one method for detecting H pylori. When PCR was used, 15 of 208 patients (7%) tested positively for H pylori by PCR in dental plaque. In contrast, only 2 samples were positive by culture. This demonstrates the importance of using more than one method for detecting H pylori infection. We also found this to be true in our own study, where we used two methods, TDI-FP and modified Giemsa stain, to detect H pylori infection. As shown in Table 1, TDI-FP consistently detected H pylori infections that were missed by the modified Giemsa stain method. These authors also found that four of the dental plaque strains had restriction patterns similar to those of the stomach and duodenal sites, providing evidence that these sites were infected with the same strain of H pylori. The detection in dental plaque could indicate that the oral cavity may act as a reservoir or sanctuary for the organism. Likewise, this finding also relates to our data. We found that H pylori infection in the pharynx was significantly more likely in patients with a history of stomach ailments than in patients without a history of stomach ailments. That is, just as there is a relationship between the occurrence of H pylori in dental plaque and its occurrence in the stomach and duodenum, there may be a relationship between infection of the pharynx with H pylori and a history of stomach ailments. However, whether H pylori is a resident or transient oral microorganism is still unclear, although it is more likely to be transient in nature[27].

In our study, the goal was to determine if there was a relationship between H pylori infection in the pharynx and chronic pharyngitis, and, in addition, to determine if such infections correlated with a history of stomach ailments. We determined both of these relationships to be true. In addition, we utilized two methods for detecting H pylori, TDI-FP and modified Giemsa stain, and found the TDI-FP method to be the most sensitive. These findings can be applied to the clinical setting: doctors will be able to use the appropriate method to test if a patient with chronic pharyngitis is infected in the pharynx with H pylori, aiding in prescribing the appropriate antibiotic. These findings also should cause doctors to examine a patient with chronic pharyngitis for ailments in the digestive system. But on the other hand, the TDI-FP test can yield false positive results.

To determine whether H pylori infection is related to other upper respiratory tract infections, such as sinusitis, or with otitis media, further investigations will need to be performed.

References
1.  Schwartz K, Monsur J, Northrup J, West P, Neale AV. Pharyngitis clinical prediction rules: effect of interobserver agreement: a MetroNet study. J Clin Epidemiol. 2004;57:142-146.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 9]  [Article Influence: 0.4]  [Reference Citation Analysis (0)]
2.  Merrill B, Kelsberg G, Jankowski TA, Danis P. Clinical inquiries. What is the most effective diagnostic evaluation of streptococcal pharyngitis. J Fam Pract. 2004;53:734, 737-78, 740.  [PubMed]  [DOI]
3.  Wang JH, Luo JY, Dong L, Gong J, Tong M. Epidemiology of gastroesophageal reflux disease: a general population-based study in Xi'an of Northwest China. World J Gastroenterol. 2004;10:1647-1651.  [PubMed]  [DOI]
4.  De Luca A, Iaquinto G. Helicobacter pylori and gastric diseases: a dangerous association. Cancer Lett. 2004;213:1-10.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 52]  [Cited by in RCA: 50]  [Article Influence: 2.3]  [Reference Citation Analysis (1)]
5.  Zhang C, Yamada N, Wu YL, Wen M, Matsuhisa T, Matsukura N. Helicobacter pylori infection, glandular atrophy and intestinal metaplasia in superficial gastritis, gastric erosion, erosive gastritis, gastric ulcer and early gastric cancer. World J Gastroenterol. 2005;11:791-796.  [PubMed]  [DOI]
6.  Zhang J, Chen XL, Wang KM, Guo XD, Zuo AL, Gong J. Relationship of gastric Helicobacter pylori infection to Barrett's esophagus and gastro-esophageal reflux disease in Chinese. World J Gastroenterol. 2004;10:672-675.  [PubMed]  [DOI]
7.  Cirak MY, Ozdek A, Yilmaz D, Bayiz U, Samim E, Turet S. Detection of Helicobacter pylori and its CagA gene in tonsil and adenoid tissues by PCR. Arch Otolaryngol Head Neck Surg. 2003;129:1225-1229.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 63]  [Cited by in RCA: 66]  [Article Influence: 2.9]  [Reference Citation Analysis (1)]
8.  Unver S, Kubilay U, Sezen OS, Coskuner T. Investigation of Helicobacter pylori colonization in adenotonsillectomy specimens by means of the CLO test. Laryngoscope. 2001;111:2183-2186.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 53]  [Cited by in RCA: 51]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
9.  Yilmaz M, Kara CO, Kaleli I, Demir M, Tümkaya F, Büke AS, Topuz B. Are tonsils a reservoir for Helicobacter pylori infection in children. Int J Pediatr Otorhinolaryngol. 2004;68:307-310.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 16]  [Cited by in RCA: 16]  [Article Influence: 0.7]  [Reference Citation Analysis (0)]
10.  Freeman BD, Buchman TG, Zehnbauer BA. Template-directed dye-terminator incorporation with fluorescence polarization detection for analysis of single nucleotide polymorphisms associated with cardiovascular and thromboembolic disease. Thromb Res. 2003;111:373-379.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 4]  [Article Influence: 0.2]  [Reference Citation Analysis (0)]
11.  Guo YH, Zhang J, Zhao JR. Dectecting HBV DNA in serum by PCR-FP. Chin J Lab Med. 2004;27:26-28.  [PubMed]  [DOI]
12.  Bai YJ, Zhao JR, Lv GT, Zhang WH, Wang Y, Yan XJ. Rapid and high throughput detection of HBV YMDD mutants with fluorescence polarization. World J Gastroenterol. 2003;9:2344-2347.  [PubMed]  [DOI]
13.  Rotimi O, Cairns A, Gray S, Moayyedi P, Dixon MF. Histological identification of Helicobacter pylori: comparison of staining methods. J Clin Pathol. 2000;53:756-759.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 101]  [Cited by in RCA: 89]  [Article Influence: 3.4]  [Reference Citation Analysis (0)]
14.  Leong RW, Lee CC, Ling TK, Leung WK, Sung JJ. Evaluation of the string test for the detection of Helicobacter pylori. World J Gastroenterol. 2003;9:309-311.  [PubMed]  [DOI]
15.  Vincent MT, Celestin N, Hussain AN. Pharyngitis. Am Fam Physician. 2004;69:1465-1470.  [PubMed]  [DOI]
16.  Romero Vivas J, Rubio Alonso M, Corral O, Pacheco S, Agudo E, Picazo JJ. [Community-acquired respiratory infections]. Enferm Infecc Microbiol Clin. 1997;15:289-298.  [PubMed]  [DOI]
17.  Fajardo Olivares M, Cordero Carrasco JL, Beteta López A, Escobar Izquierdo AB, Sacristán Enciso B. [Pharyngitis due to Burkholderia cepacia. Person-to-person transmission]. An Pediatr (Barc). 2004;60:581-582.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3]  [Cited by in RCA: 2]  [Article Influence: 0.1]  [Reference Citation Analysis (0)]
18.  Esposito S, Blasi F, Bosis S, Droghetti R, Faelli N, Lastrico A, Principi N. Aetiology of acute pharyngitis: the role of atypical bacteria. J Med Microbiol. 2004;53:645-651.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 58]  [Cited by in RCA: 48]  [Article Influence: 2.2]  [Reference Citation Analysis (0)]
19.  Wu TC, Chen LK, Hwang SJ. Seroprevalence of Helicobacter pylori in school-aged Chinese in Taipei City and relationship between ABO blood groups. World J Gastroenterol. 2003;9:1752-1755.  [PubMed]  [DOI]
20.  Rolle-Kampczyk UE, Fritz GJ, Diez U, Lehmann I, Richter M, Herbarth O. Well water--one source of Helicobacter pylori colonization. Int J Hyg Environ Health. 2004;207:363-368.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 33]  [Cited by in RCA: 28]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
21.  Siddiq M, Haseeb-ur-Rehman A. Evidence of Helicobacter pylori infection in dental plaque and gastric mucosa. J Coll Physicians Surg Pak. 2004;14:205-207.  [PubMed]  [DOI]
22.  Nasrolahei M, Maleki I, Emadian O. Helicobacter pylori colonization in dental plaque and gastric infection. Rom J Gastroenterol. 2003;12:293-296.  [PubMed]  [DOI]
23.  Akbayir N, Başak T, Seven H, Sungun A, Erdem L. Investigation of Helicobacter pylori colonization in laryngeal neoplasia. Eur Arch Otorhinolaryngol. 2005;262:170-172.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 34]  [Cited by in RCA: 34]  [Article Influence: 1.6]  [Reference Citation Analysis (0)]
24.  Crowe SE. Helicobacter infection, chronic inflammation, and the development of malignancy. Curr Opin Gastroenterol. 2005;21:32-38.  [PubMed]  [DOI]
25.  Kashiwagi H. Ulcers and gastritis. Endoscopy. 2005;37:110-115.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 10]  [Cited by in RCA: 7]  [Article Influence: 0.3]  [Reference Citation Analysis (0)]
26.  Sano N, Ohara S, Koike T, Sekine H, Imatani A, Kitagawa Y, Dairaku N, Iijima K, Kato K, Shimosegawa T. [Influence of urease activity of the oral cavity and oropharynx on 13C-urea breath test]. Nihon Shokakibyo Gakkai Zasshi. 2004;101:1302-1308.  [PubMed]  [DOI]
27.  Oshowo A, Gillam D, Botha A, Tunio M, Holton J, Boulos P, Hobsley M. Helicobacter pylori: the mouth, stomach, and gut axis. Ann Periodontol. 1998;3:276-280.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 43]  [Cited by in RCA: 41]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
28.  Chen X, Kwok PY. Template-directed dye-terminator incorporation (TDI) assay: a homogeneous DNA diagnostic method based on fluorescence resonance energy transfer. Nucleic Acids Res. 1997;25:347-353.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 89]  [Cited by in RCA: 81]  [Article Influence: 2.8]  [Reference Citation Analysis (0)]
Footnotes

S- Editor Guo SY L- Editor Elsevier HK E- Editor Kong LH

Write to the Help Desk