BPG is committed to discovery and dissemination of knowledge
Basic Research Open Access
©2006 Baishideng Publishing Group Co., Limited. All rights reserved.
World J Gastroenterol. Jul 14, 2006; 12(26): 4143-4148
Published online Jul 14, 2006. doi: 10.3748/wjg.v12.i26.4143
Amplification of chromosome 21q22.3 harboring trefoil factor family genes in liver fluke related cholangiocarcinoma is associated with poor prognosis
Kanuengnuch Muenphon, Temduang Limpaiboon, Patcharee Jearanaikoon, Department of Clinical Chemistry, Center for Research and Development of Medical Diagnostic Laboratories, Faculty of Associated Medical Sciences, Khon Kaen University, Khon Kaen 40002, Thailand
Chawalit Pairojkul, Banchob Sripa, Department of Pathology, Liver Fluke and Cholangiocarcinoma Research Center, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002, Thailand
Vajarabhongsa Bhudhisawasdi, Department of Surgery, Liver Fluke and Cholangiocarcinoma Research Center, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002, Thailand
Co-first-author: Temduang Limpaiboon
Supported by the Research Grants from Khon Kaen University, No. 48-03-1-01-03; the Center for Research and Development in Medical Diagnostic Laboratories, Faculty of Associated Medical Sciences, No 06-01
Correspondence to: Dr. Temduang Limpaiboon, Department of Clinical Chemistry, Center for Research and Development of Medical Diagnostic Laboratories, Faculty of Associated Medical Sciences, Khon Kaen University, Khon Kaen 40002, Thailand. temduang@kku.ac.th
Telephone: +66-43-362028 Fax: +66-43-202088
Received: March 14, 2006
Revised: March 20, 2006
Accepted: March 27, 2006
Published online: July 14, 2006

Abstract

AIM: To determine allelic imbalance on chromosomal region 21q22-qter including trefoil factor family genes (TFF) in cholangiocarcinoma (CCA) patients and analyze the correlation between allelic imbalances and clinicopathological parameters.

METHODS: Quantitative PCR amplification was performed on four microsatellite markers and trefoil factor family genes (TFF1, TFF2, and TFF3) using a standard curve and SYBR Green I dye method. The relative copy number was determined by DNA copy number of tested locus to reference locus. The relative copy number was interpreted as deletion or amplification by comparison with normal reference range. Associations between allelic imbalance and clinicopathological parameters of CCA patients were evaluated by χ2-tests. Kaplan-Meier method was used to analyze survival.

RESULTS: The frequencies of amplification at D21S1890, D21S1893, and TFF3 were 32.5%, 30.0%, and 28.7%, respectively. Patients who had amplification at regions covering D21S1893, D21S1890, and TFF showed poor prognosis, whereas patients who had deletion showed favorable prognosis (mean: 51.7 wk vs 124.82 wk, P = 0.012). Multivariate Cox regression analysis revealed that amplification of D21S1893, D21S1890 and TFF, blood vessel invasion, and staging were associated with poor prognosis.

CONCLUSION: D21S1893-D21S1890 region may harbor candidate genes especially TFF and serine protease family, which might be involved in tumor invasion and metastasis contributing to poor survival. The amplification in this region may be used as a prognostic marker in the treatment of CCA patients.

Key Words: Cholangiocarcinoma; Amplification on chromosome 21; Trefoil factor family; Quantitative PCR; Liver fluke



INTRODUCTION

Cholangiocarcinoma (CCA) or intrahepatic bile duct cancer (ICC) is a malignant tumor in the biliary tree peripheral to the bifurcation of the right and left hepatic duct[1,2]. Incidence rates of ICC vary substantially worldwide, reflecting the distribution of local geographic risk factors, in addition to genetic differences among various populations. In Western countries, the disease is rare, however, it is highly frequent in Southeast Asia, especially in Khon Kaen, Northeast Thailand. Truncated age-standardized incidence of CCA at ages > 35 years varied by three fold between districts, from 93.8 to 317.6 per 100 000 population[3]. In Western countries, primary sclerosing cholangitis is the commonest known predisposing condition for this cancer. Eight percent to 40% of CCA have been reported in patients with primary sclerosing cholangitis[4]. Several clinical studies and animal model experimental studies suggest that the interaction between chemical carcinogens, especially nitrosamines and Opisthorcis viverrini infestation may play an important role in the development of CCA in Thailand[5-7]. Thus, either the chemical carcinogen nitrosamine or liver fluke infection alone does not produce cancer. Food derived exogenous and in situ nitrosamine formation may lead to DNA alkylation and also deamination in predisposed and inflamed tissues. Furthermore, chronic irritation caused by the fluke results in hyperplasia and adenomatous change of bile duct epithelium[6]. The DNA damaged biliary epithelium may then be transformed to malignant CCA[7-9]. To date, the molecular basis of carcinogenesis and pathogenesis of cholangiocarcinoma is still unclear.

Allelic imbalance at specific genomic loci is an important step in the molecular genetic analysis of human cancers. Allelic imbalance at chromosome 21, especially region 21q22-qter, was found in several types of human cancers such as gastric cancer, breast cancer, ovarian clear cell adenocarcinoma, and primary colorectal cancer[10-13]. Furthermore, chromosome 21q22.3 harbors a cluster of trefoil factor family (TFF) genes consisting of TFF1, TFF2, and TFF3[14]. TFF functions include mucus stabilization and stimulation of normal epithelial cell restitution during wound repair through motogenic and antiapoptotic activities. However, TFF peptides are overexpressed in several human solid tumors such as prostate, esophagus, breast, and pancreas and also function as tumor progression factor[15-18]. Prolonged inflammation caused by parasitic infection frequently occurs in liver fluke related CCA. TFF and its neighborhood located at 21q22 may be involved in tumor development and progression. Moreover, our data on comparative genomic hybridization (CGH) in CCA showed the alteration of DNA copy number at 21q22-qter at 28%.

Taken these data together, the chromosomal region 21q22-qter may harbor candidate genes, which are involved in carcinogenesis and pathogenesis of CCA. Therefore, this study attempted to determine allelic imbalance on chromosomal region 21q22-qter including TFF genes to define affected sites for candidate genes which are involved in molecular carcinogenesis and pathogenesis of CCA. The associations between allelic imbalance and clinicopathological parameters were also determined.

MATERIALS AND METHODS
Samples and DNA preparation

This project was approved by the Ethical Committee of Khon Kaen University. Informed consents were obtained from patients who were willing to participate in the project. Frozen liver tissues were obtained from 80 CCA patients undergoing surgical resection at Srinagarind Hospital, Faculty of Medicine, Khon Kaen University, Thailand. CCA cases were diagnosed by physicians according to clinical finding, laboratory investigation and histological examination. Neural, blood vessel and lymphatic invasion were assessed by standard method[19]. The clinicopathological data such as age, gender, histological type, and TNM stage[20] were evaluated by reviewing the medical charts and pathology records. DNA was prepared from frozen liver tissues containing 80% of tumor cells by using a PuregeneTM DNA purification system (Gentra System, USA) according to manufacturer’s instructions. In addition, DNA was prepared from placental tissue collected from a normal labor (postpartum) woman and used for setting a standard curve. Normal leukocyte DNA derived from 50 healthy donors was prepared into 14 pooled normal DNA and generated for normal reference range.

Quantitative PCR assay

Quantitative PCR amplification was performed on a Rotor Gene 2000 Real-time Amplification (Corbett Research, Australia) using four microsatellite markers (telomere-D21S1890-D21S1893-D21S1255-D21S1253-centromere) and trefoil factor family genes (TFF1, TFF2, and TFF3) covering chromosomal region 21q21-qter. Reference primers were chosen in the region of the housekeeping genes that usually are not altered alteration in CCA, β-actin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Primer sequences were obtained from the Genome Data Base. Locations of selected oligonucleotides and their sequences are shown in Table 1. PCR reaction was performed in a 25 μL reaction mixture containing 50 mmol/L KCl, 10 mmol/L Tris HCl pH 8.3, 100 μmol/L each of deoxynucleoside triphosphate (dNTP), 2.5 mmol/L MgCl2 or 3.0 mmol/L (D21S1253, TFF1, and β-actin), 1.25 μL SYBR® Green I dye solution (Amresco, USA) (1:10 000 in DMSO), and 10 μmol/L or 5 μmol/L (D21S1253 and D21S1255) or 15 μmol/L (D21S1890) of each primer with 1.5 units or 2.0 units (D21S1253, D21S1255, and GAPDH) of Taq DNA polymerase. The PCR was performed at 95°C for 5 min followed by 95°C for 15 s, 45°C -60°C for 15 s and 72°C for 15 s for 35 cycles with an additional cycle of 72°C for 10 min.

Table 1 Locations and sequences of microsatellite markers, trefoil factor family genes and reference loci.
Primer nameChromosomeProduct size (bp)Forward primerReverse primer
D21S125321q21.3174-190GAAGAATCTCCCGAACCAGGAAGACCAGTGTTATTCAGAGCC
D21S125521q22.2112-126AGCTCTTTATTTTGCCACATAGCTGCATGTTTGCCTGG
D21S189321q22.2111-119GTATGCACACCACACGGTAACAAAATCCGCCACG
D21S189021q22.3143-173GGTCTGACCACAGATTTCCAAAAACACTCTGAACGATTAAGG
Trefoil factor family 121q22.3219CAGGGATCTGCCTGCATCATCGATCTCTTTTAATTTTTAGGCC
Trefoil factor family 221q22.3123GAAGAATCTCCCGAACCAGGGTCACACTTCAAAAACTAGAGG
Trefoil factor family 321q22.3129CAGGCACTGTTCATCTCAGCTATTCGTTAAGACATCAGGCTCC
β-actin7p15375TCACCCACACTGTGCCCATCTACGACAGCGGAACCGCTCATTGCCAATGG
GAPDH112p13250ACAGTCCATGCCATCACTGCCGCCTGCTTCACCACCTTCTTG

Quantitative PCR amplification was performed using a standard curve and SYBR Green I dye method as described previously[21]. The standard curve for each primer was generated using serial dilutions of placental DNA. The standard curve was constructed in each PCR run and the copy numbers of genes in each sample were interpolated using these standard curves. Placental DNA with known concentration was used for precision control. A coefficient of variation (CV) of each sample was determined based on triplicate test. The sample with a CV higher than 15% was re-tested. DNA copy number of each locus was calculated based on triplicate determination and duplicate PCR run.

Analysis of allelic imbalance

The relative copy number was determined by DNA copy number of tested locus to DNA copy number of reference locus. The DNA copy numbers of reference loci consisting of β-actin and GAPDH were averaged before calculation. The normal reference range was generated from the relative copy numbers of 14 pooled normal leukocyte DNA of 7 markers (n = 98). If the relative copy number of sample calculated differed significantly from normal reference range (mean ± 2SD), the sample was verified as loss or gain. The relative copy number was interpreted as loss when the ratio was less than mean -2SD of normal reference range. On the other hand, the relative copy number was interpreted as gain when the ratio was more than mean + 2SD of normal reference range.

Statistical analysis

Associations between allelic imbalance and clinicopathological parameters of 80 CCA patients were evaluated by means of the χ2-tests. Survival curves for patients with allelic imbalance versus those without were calculated using the Kaplan-Meier method. Only 69 cases were available for follow-up. Six patients were lost for follow-up and five cases were perioperative death (patients who died within 4 wk after surgery). Differences in survival between these two groups were assessed by the log-rank test. Cox proportional hazards model was used in univariate and multivariate analysis. P < 0.05 was considered statistically significant.

RESULTS
Allelic imbalance on chromosomal region 21q22-qter

The normal reference range generated from relative copy numbers of pooled normal leukocyte DNA was 0.54-1.34 with 95% confidence interval (mean ± 2SD). Allelic imbalance of 7 loci showed percentages of amplification at D21S1890 (32.5%), D21S1893 (30.0%), TFF3 (28.8%), D21S1253 (26.3%), D21S1255 (23.8%), TFF1 (22.5%), and TFF2 (7.5%) and of deletion at TFF3 (3.8%), D21S1255 (2.5%), TFF2 (2.5%), and D21S1890 (1.3%). The relative copy number of amplification of these loci ranged between 1.35-4.24 and of deletion between 0.39-0.52. Fine mapping of these regions is shown in Figure 1. Two regions of common amplification were D21S1890 and the region between D21S1893 and TFF3.

Figure 1
Figure 1 Fine mapping of allelic imbalance on chromosomal region 21q22-qter. D21S1890 is located at telomeric end while D21S1253 is located toward centromeric end. There are two common amplification regions at D21S1890 and the region between D21S1893 and TFF3.
Associations between allelic imbalance and clinicopathological parameters of patients

The associations between allelic imbalance and clinicopathological parameters of patients were analyzed. The result showed no differences in age, sex, histological type, invasion (blood vessel, lymphatic, and nerve), and survival time between patients with and without allelic imbalance in almost all loci (P > 0.050). However, significant difference was observed in histological type at loci covering D21S1893 through D21S1890 including TFF (P = 0.023). Deletion at D21S1893, D21S1890, and TFF found in a papillary type was higher than that in a non-papillary one (Table 2). Furthermore, patients who had deletion in this region tended to show non-invasion of blood vessel (P = 0.052) (Table 2). Kaplan-Meier survival curves demonstrated that patients who had amplification at D21S1893, D21S1890, and TFF showed poor prognosis, whereas patients who had deletion at D21S1893, D21S1890, and TFF showed favorable prognosis (P = 0.012) (Figure 2). Multivariate analysis showed significant effects of amplification at D21S1893, D21S1890, and TFF, blood vessel invasion, and staging on prognosis (Table 3).

Table 2 Clinicopathological parameters of patients with and without allelic imbalance.
Clinical parametersnGene/microsatellite makersD21S1893, D21S1890 and TFF
Normaln (%)Amplificationn (%)Deletionln (%)P value
Age (yr)80
≤ 543918 (46)20 (51)1 (3)NS
> 544115 (36)22 (54)4 (10)
Gender80
Male5722 (39)32 (56)3 (5)NS
Famale2311 (48)10 (43)2 (9)
Histological type80
Non-Papillary adenocarcinoma5827 (46)30 (52)1 (2)0.023
Papillary adenocarcinoma226 (27)12 (55)4 (18)
Staging80
II & III105 (50)5 (50)-NS
IVA & IVB7028 (40)37 (52.8)5 (7.2)
Blood vessel invasion79
Non-invasion288 (29)16 (57)4 (14)NS
Invasion5124 (47)26 (51)1 (2)
Lymphatic invasion79
Non-invasion154 (27)11 (73)-NS
Invasion6428 (43)31 (49)5 (8)
Nerve invasion79
Non-invasion3614 (39)19 (53)3 (8)NS
Invasion4318 (42)23 (54)2 (4)
Survival time (wk)690.012
Mean54.1251.7124.82
Median4927.484.28
Minimum-maximum7.14-119.284.85-242.8567.71-143.85
Figure 2
Figure 2 The association between survival time and allelic imbalance on loci D21S1893, D21S1890 and TFF was analyzed by Kaplan-Meier. The patients who had amplification at D21S1893, D21S1890 and TFF showed poor prognosis, whereas patients who had deletion at D21S1893, D21S1890 and TFF showed favorable prognosis.
Table 3 Univariate and multivariate analysis of overall survival in cholangiocarcinoma.
VariablenUnivariate
Multivariate
Relative risk(95%CI)P valueRelative risk(95%CI)P value
Age (yr)690.831 (0.483-1.430)NS
≤ 5434
> 5435
Gender690.443 (0.231-0.849)0.0140.628 (0.312-1.263)NS
Male49
Famale20
Histological type690.622 (0.332-1.167)NS
Non-Papillary adenocarcinoma50
Papillary adenocarcinoma19
Staging692.265 (0.899-5.708)0.0833.320 (1.270-8.681)0.014
II & III9
IVA & IVB60
Blood vessel invasion692.108 (1.139-3.902)0.0182.183 (1.088-4.382)0.028
Non-invasion23
Invasion46
Lymphatic invasion690.981 (0.479-2.012)NS
Non-invasion12
Invasion57
Nerve invasion691.129 (0.654-1.950)NS
Non-invasion32
Invasion37
D21S1893, D21S1890, and TFF690.0260.002
Normal30ReferenceReference
Amplification351.707 (0.974-2.991)NS2.473 (1.342-4.557)0.004
Deletion40.187 (0.025-1.394)NS0.224 (0.029-1.701)NS
DISCUSSION

Many techniques have been used to detect genetic alterations. The real-time qPCR technique is an alternative method to determine allelic imbalance because most allelic imbalances also result in changes of relative copy numbers. In our study, allelic imbalance determined by qPCR using SYBR Green I system showed CV less than 15%, suggesting good consistency and reliability[21]. The house keeping genes, β-actin and GAPDH, were used as reference loci in our study. To assess the validity of these reference genes, we determined the copy number ratios of β-actin/GAPDH in 14 pooled normal leukocytes and 80 CCA samples. The observed ratios measured from normal DNA (1.01 ± 0.14SD) and tumor DNA (1.06 ± 0.15SD) were similar

(P = 0.271) and both were significantly equal to 1, thus, confirming their validity as appropriate reference genes in our work.

Our finding of allelic imbalance on chromosomal region 21q22-qter in CCA patients showed predominant amplifications at markers D21S1890 (32.5%) and D21S1893 (30%). This region has length about 3.5 Mb in physical map distance and contains about 25 identified genes. Trefoil factor family (TFF1, TFF2, and TFF3) and serine protease family (TMPRSS2 and TMPRSS3) are candidate genes located in this region and have a potential tumor progression activity. In this study, all CCA tissues were obtained from patients who were residents of northeastern region of Thailand where liver fluke infection remains highly endemic. Increased gene amplification at chromosome 21q22.3 especially TFF genes in liver fluke related CCA may result from healing process of inflamed tissues. Normally, TFF peptides are involved in the normal mucosal defense and epithelial restitution in cell injury. However, in chronic inflammation, the overproduction of TFF peptides may result in tumor progression. TFF peptides might exert beneficial effects during the early step of mucosal injury and inflammation and subsequently undesirable effects during chronic inflammation and neoplastic progression. TFF peptides function as a tumor progression factor by increasing cell scattering, invasion, survival and proangiogenesis[22-25]. TFF3 stimulates cell motility by inducing a rapid phosphorylation of β-catenin, which is associated with perturbation of the functional integrity of E-cadherin/catenin system. The promotion of cell motility in association with epidermal growth factor receptor (EGFR) leads to the enhancement of tumor cell invasion and metastasis[26,27]. However, exogenous TFF peptides alone are not sufficient to induce the invasive phenotype in premalignant human colonic adenoma cells PC/AA/C1 and kidney MDCK epithelial cells, but require the priming and permissive action of src and RhoA to exert their proinvasive activity[22]. These observations suggest that trefoil peptides elicit a coordinated cellular response enabling cell migration without triggering the programmed cell death response usually precipitated by cell detachment from a stationary anchored state. TFF1 protects cells from anoikis, chemical-, or Bad-induced apoptosis by reducing caspase-3, caspase-6, caspase-8, and caspase-9 activities[25]. TFF3 may act as anti-apoptosis by preventing p53-dependent and p53-independent apoptosis pathways[28]. The anti-apoptotic effects of TFF3 are associated with activation of the PI3K-Akt signaling pathway. Thus, TFF functions as an anti-apoptosis factor, resulting in an increase in number of survived cancer cells through proliferation via Ras/MEK/MAP kinase signaling transduction pathway. Angiogenic activity of TFF is comparable to that induced by vascular endothelial growth factor (VEGF), leptin, and transforming growth factor-alpha. Stimulation of angiogenesis by TFF1 in the chick chorioallantoic membrane (CAM) assay was COX-2- and EGFR-dependent, but independent of the VEGF receptor KDR/flk-1 and the thromboxane A2 receptor (TXA-2-R). These results implicate a role of TFF in the formation of new blood vessels during normal and pathophysiological processes linked to wound healing, inflammation, and cancer progression[23].

Transmembrane protease, serine 2 (TMPRSS2) and transmembrane protease, serine 3 (TMPRSS3) are members of serine protease family. Proteases have been increasingly recognized as important factors in the pathophysiology of tumorous diseases. Members of the endopeptidases, such as serine protease family, mediate the proteolytic degradation of the extracellular matrix, which is an indispensable step in tumor invasion and metastasis[29]. TMPRSS2 was highly expressed in prostate cancer and correlated with the metastatic potential and involved in microvascular endothelial cell reorganization and capillary morphogenesis[30,31]. TMPRSS3 is strongly expressed in a subset of pancreatic cancer and various other cancer tissues, and its expression correlates with the metastatic potential of the clonal SUIT-2 pancreatic cancer cell lines[32]. The data suggested that both TMPRSS2 and TMPRSS3 may be important for the processes involved in metastasis, invasion, and angiogenesis in tumor cells. Our study showed high amplifications of markers D21S1893 and D21S1890, suggesting that existence of candidate genes might be involved in pathogenesis of CCA. The data regarding the involvement of serine protease and TFF in aggressive feature and metastasis supported our finding that amplifications of candidate genes at regions D21S1893, D21S1890, and TFF were found in poor prognostic CCA patients. Clinical data of CCA patients supported our hypothesis that TFF stimulated cell motility via E-cadherin/catenin and APC complexes and promoted tumor cell survival by anti-apoptosis, while serine protease mediated vascular endothelial invasion and angiogenesis leading to poor survival in CCA patients. Although the differences in genetic alterations between liver fluke related and non-liver fluke related CCA have been observed previously[33,34], the conclusion regarding the difference between these two groups in allelic imbalance on chromosome 21q22 cannot be drawn.

As far as we know, allelic imbalance on the chromosomal region 21q22-qter including TFF in CCA patients is first reported by our group. The protein expression and functions of TMPRSS2, TMPRSS3, and TFF related to cancer invasion and metastasis in liver fluke related CCA patients require further study. The application of allelic imbalance on D21S1893, D21S1890, and TFF may be of value as a prognostic marker and a selection for CCA patient treatment.

References
1.  Uttaravichien T, Bhudhisawasdi V, Pairojkul C, Pugkhem A. Intrahepatic cholangiocarcinoma in Thailand. J Hepatobiliary Pancreat Surg. 1999;6:128-135.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 28]  [Cited by in RCA: 31]  [Article Influence: 1.1]  [Reference Citation Analysis (0)]
2.  Nakanuma Y, Hoso M, Sanzen T, Sasaki M. Microstructure and development of the normal and pathologic biliary tract in humans, including blood supply. Microsc Res Tech. 1997;38:552-570.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 9]  [Reference Citation Analysis (2)]
3.  Sriamporn S, Pisani P, Pipitgool V, Suwanrungruang K, Kamsa-ard S, Parkin DM. Prevalence of Opisthorchis viverrini infection and incidence of cholangiocarcinoma in Khon Kaen, Northeast Thailand. Trop Med Int Health. 2004;9:588-594.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 207]  [Cited by in RCA: 193]  [Article Influence: 8.8]  [Reference Citation Analysis (0)]
4.  Shaib Y, El-Serag HB. The epidemiology of cholangiocarcinoma. Semin Liver Dis. 2004;24:115-125.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 905]  [Cited by in RCA: 834]  [Article Influence: 37.9]  [Reference Citation Analysis (5)]
5.  Watanapa P, Watanapa WB. Liver fluke-associated cholangiocarcinoma. Br J Surg. 2002;89:962-970.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 237]  [Cited by in RCA: 184]  [Article Influence: 7.7]  [Reference Citation Analysis (1)]
6.  Bhamarapravati N, Thammavit W, Vajrasthira S. Liver changes in hamsters infected with a liver fluke of man, Opisthorchis viverrini. Am J Trop Med Hyg. 1978;27:787-794.  [PubMed]  [DOI]
7.  Thamavit W, Kongkanuntn R, Tiwawech D, Moore MA. Level of Opisthorchis infestation and carcinogen dose-dependence of cholangiocarcinoma induction in Syrian golden hamsters. Virchows Arch B Cell Pathol Incl Mol Pathol. 1987;54:52-58.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 64]  [Cited by in RCA: 65]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
8.  Thamavit W, Moore MA, Hiasa Y, Ito N. Enhancement of DHPN induced hepatocellular, cholangiocellular and pancreatic carcinogenesis by Opisthorchis viverrini infestation in Syrian golden hamsters. Carcinogenesis. 1988;9:1095-1098.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 25]  [Cited by in RCA: 20]  [Article Influence: 0.5]  [Reference Citation Analysis (2)]
9.  Thamavit W, Pairojkul C, Tiwawech D, Shirai T, Ito N. Strong promoting effect of Opisthorchis viverrini infection on dimethylnitrosamine-initiated hamster liver. Cancer Lett. 1994;78:121-125.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 35]  [Cited by in RCA: 36]  [Article Influence: 1.1]  [Reference Citation Analysis (0)]
10.  Ohgaki K, Iida A, Kasumi F, Sakamoto G, Akimoto M, Nakamura Y, Emi M. Mapping of a new target region of allelic loss to a 6-cM interval at 21q21 in primary breast cancers. Genes Chromosomes Cancer. 1998;23:244-247.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 1]  [Reference Citation Analysis (2)]
11.  Suehiro Y, Sakamoto M, Umayahara K, Iwabuchi H, Sakamoto H, Tanaka N, Takeshima N, Yamauchi K, Hasumi K, Akiya T. Genetic aberrations detected by comparative genomic hybridization in ovarian clear cell adenocarcinomas. Oncology. 2000;59:50-56.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 53]  [Cited by in RCA: 42]  [Article Influence: 1.6]  [Reference Citation Analysis (0)]
12.  Park WS, Oh RR, Park JY, Yoo NJ, Lee SH, Shin MS, Kim SY, Kim YS, Lee JH, Kim HS. Mapping of a new target region of allelic loss at 21q22 in primary gastric cancers. Cancer Lett. 2000;159:15-21.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 29]  [Cited by in RCA: 30]  [Article Influence: 1.2]  [Reference Citation Analysis (0)]
13.  Aragane H, Sakakura C, Nakanishi M, Yasuoka R, Fujita Y, Taniguchi H, Hagiwara A, Yamaguchi T, Abe T, Inazawa J. Chromosomal aberrations in colorectal cancers and liver metastases analyzed by comparative genomic hybridization. Int J Cancer. 2001;94:623-629.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 61]  [Cited by in RCA: 59]  [Article Influence: 2.4]  [Reference Citation Analysis (0)]
14.  Thim L. A new family of growth factor-like peptides. 'Trefoil' disulphide loop structures as a common feature in breast cancer associated peptide (pS2), pancreatic spasmolytic polypeptide (PSP), and frog skin peptides (spasmolysins). FEBS Lett. 1989;250:85-90.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 171]  [Cited by in RCA: 171]  [Article Influence: 4.6]  [Reference Citation Analysis (0)]
15.  Colombel M, Dante R, Bouvier R, Ribieras S, Pangaud C, Marechal JM, Lasne Y. Differential RNA expression of the pS2 gene in the human benign and malignant prostatic tissue. J Urol. 1999;162:927-930.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 18]  [Cited by in RCA: 17]  [Article Influence: 0.6]  [Reference Citation Analysis (1)]
16.  Labouvie C, Machado JC, Carneiro F, Sarbia M, Vieth M, Porschen R, Seitz G, Blin N. Differential expression of mucins and trefoil peptides in native epithelium, Barrett's metaplasia and squamous cell carcinoma of the oesophagus. J Cancer Res Clin Oncol. 1999;125:71-76.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 28]  [Cited by in RCA: 28]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
17.  May FE, Westley BR. Expression of human intestinal trefoil factor in malignant cells and its regulation by oestrogen in breast cancer cells. J Pathol. 1997;182:404-413.  [PubMed]  [DOI]  [Full Text]
18.  Terris B, Blaveri E, Crnogorac-Jurcevic T, Jones M, Missiaglia E, Ruszniewski P, Sauvanet A, Lemoine NR. Characterization of gene expression profiles in intraductal papillary-mucinous tumors of the pancreas. Am J Pathol. 2002;160:1745-1754.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 181]  [Cited by in RCA: 172]  [Article Influence: 7.2]  [Reference Citation Analysis (1)]
19.  Nakanuma Y, Harada K, Ishikawa A, Zen Y, Sasaki M. Anatomic and molecular pathology of intrahepatic cholangiocarcinoma. J Hepatobiliary Pancreat Surg. 2003;10:265-281.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 98]  [Cited by in RCA: 78]  [Article Influence: 3.4]  [Reference Citation Analysis (1)]
20.  Tio TL, Wijers OB, Sars PR, Tytgat GN. Preoperative TNM classification of proximal extrahepatic bile duct carcinoma by endosonography. Semin Liver Dis. 1990;10:114-120.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 12]  [Cited by in RCA: 10]  [Article Influence: 0.3]  [Reference Citation Analysis (0)]
21.  De Preter K, Speleman F, Combaret V, Lunec J, Laureys G, Eussen BH, Francotte N, Board J, Pearson AD, De Paepe A. Quantification of MYCN, DDX1, and NAG gene copy number in neuroblastoma using a real-time quantitative PCR assay. Mod Pathol. 2002;15:159-166.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 152]  [Cited by in RCA: 138]  [Article Influence: 5.8]  [Reference Citation Analysis (0)]
22.  Emami S, Le Floch N, Bruyneel E, Thim L, May F, Westley B, Rio M, Mareel M, Gespach C. Induction of scattering and cellular invasion by trefoil peptides in src- and RhoA-transformed kidney and colonic epithelial cells. FASEB J. 2001;15:351-361.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 85]  [Cited by in RCA: 87]  [Article Influence: 3.5]  [Reference Citation Analysis (0)]
23.  Rodrigues S, Nguyen QD, Faivre S, Bruyneel E, Thim L, Westley B, May F, Flatau G, Mareel M, Gespach C. Activation of cellular invasion by trefoil peptides and src is mediated by cyclooxygenase- and thromboxane A2 receptor-dependent signaling pathways. FASEB J. 2001;15:1517-1528.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 59]  [Cited by in RCA: 58]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
24.  Prest SJ, May FE, Westley BR. The estrogen-regulated protein, TFF1, stimulates migration of human breast cancer cells. FASEB J. 2002;16:592-594.  [PubMed]  [DOI]
25.  Bossenmeyer-Pourié C, Kannan R, Ribieras S, Wendling C, Stoll I, Thim L, Tomasetto C, Rio MC. The trefoil factor 1 participates in gastrointestinal cell differentiation by delaying G1-S phase transition and reducing apoptosis. J Cell Biol. 2002;157:761-770.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 132]  [Cited by in RCA: 139]  [Article Influence: 5.8]  [Reference Citation Analysis (1)]
26.  Liu D, el-Hariry I, Karayiannakis AJ, Wilding J, Chinery R, Kmiot W, McCrea PD, Gullick WJ, Pignatelli M. Phosphorylation of beta-catenin and epidermal growth factor receptor by intestinal trefoil factor. Lab Invest. 1997;77:557-563.  [PubMed]  [DOI]
27.  Efstathiou JA, Noda M, Rowan A, Dixon C, Chinery R, Jawhari A, Hattori T, Wright NA, Bodmer WF, Pignatelli M. Intestinal trefoil factor controls the expression of the adenomatous polyposis coli-catenin and the E-cadherin-catenin complexes in human colon carcinoma cells. Proc Natl Acad Sci USA. 1998;95:3122-3127.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 106]  [Cited by in RCA: 116]  [Article Influence: 4.1]  [Reference Citation Analysis (0)]
28.  Kinoshita K, Taupin DR, Itoh H, Podolsky DK. Distinct pathways of cell migration and antiapoptotic response to epithelial injury: structure-function analysis of human intestinal trefoil factor. Mol Cell Biol. 2000;20:4680-4690.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 158]  [Cited by in RCA: 150]  [Article Influence: 5.8]  [Reference Citation Analysis (1)]
29.  DeClerck YA, Imren S. Protease inhibitors: role and potential therapeutic use in human cancer. Eur J Cancer. 1994;30A:2170-2180.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 84]  [Cited by in RCA: 83]  [Article Influence: 2.6]  [Reference Citation Analysis (0)]
30.  Aimes RT, Zijlstra A, Hooper JD, Ogbourne SM, Sit ML, Fuchs S, Gotley DC, Quigley JP, Antalis TM. Endothelial cell serine proteases expressed during vascular morphogenesis and angiogenesis. Thromb Haemost. 2003;89:561-572.  [PubMed]  [DOI]
31.  Vaarala MH, Porvari K, Kyllönen A, Lukkarinen O, Vihko P. The TMPRSS2 gene encoding transmembrane serine protease is overexpressed in a majority of prostate cancer patients: detection of mutated TMPRSS2 form in a case of aggressive disease. Int J Cancer. 2001;94:705-710.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 72]  [Cited by in RCA: 77]  [Article Influence: 3.1]  [Reference Citation Analysis (0)]
32.  Wallrapp C, Hähnel S, Müller-Pillasch F, Burghardt B, Iwamura T, Ruthenbürger M, Lerch MM, Adler G, Gress TM. A novel transmembrane serine protease (TMPRSS3) overexpressed in pancreatic cancer. Cancer Res. 2000;60:2602-2606.  [PubMed]  [DOI]
33.  Kiba T, Tsuda H, Pairojkul C, Inoue S, Sugimura T, Hirohashi S. Mutations of the p53 tumor suppressor gene and the ras gene family in intrahepatic cholangiocellular carcinomas in Japan and Thailand. Mol Carcinog. 1993;8:312-318.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 72]  [Cited by in RCA: 65]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
34.  Limpaiboon T, Krissadarak K, Sripa B, Jearanaikoon P, Bhuhisawasdi V, Chau-in S, Romphruk A, Pairojkul C. Microsatellite alterations in liver fluke related cholangiocarcinoma are associated with poor prognosis. Cancer Lett. 2002;181:215-222.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 28]  [Cited by in RCA: 25]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
Footnotes

S- Editor Pan BR L- Editor Zhu LH E- Editor Liu Y

Write to the Help Desk