EL-Awady MK, Tabll AA, Atef K, Yousef SS, Omran MH, El-Abd Y, Bader-Eldin NG, Salem AM, Zohny SF, El-Garf WT. Antibody to E1 peptide of hepatitis C virus genotype 4 inhibits virus binding and entry to HepG2 cells in vitro. World J Gastroenterol 2006; 12(16): 2530-2535 [PMID: 16688798 DOI: 10.3748/wjg.v12.i16.2530]
Corresponding Author of This Article
Dr. Mostafa K El-Awady, Department of Biomedical Technology, National Research Center, Tahrir Street, PO 12622, Dokki, Cairo, Egypt. mkawady@yahoo.com
Article-Type of This Article
Viral Hepatitis
Open-Access Policy of This Article
This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/4.0/
Mostafa K EL-Awady, Ashraf A Tabll, Khaled Atef, Samar S Yousef, Moataza H Omran, Yasmin El-Abd, Noha G Bader-Eldin, Wael T El-Garf, Department of Biomedical Technology, National Research Center, Cairo, Egypt
Ahmad M Salem, Samir F Zohny, Department of Biochemistry, Faculty of Science, Ain Shams University, Cairo, Egypt
ORCID number: $[AuthorORCIDs]
Author contributions: All authors contributed equally to the work.
Supported by the Ministry of Scientific Research, Academy of Scientific Research and Technology, Medical Research Council Code: P5-MED-030-01 and US-Egypt joint project BIO7-002-011
Correspondence to: Dr. Mostafa K El-Awady, Department of Biomedical Technology, National Research Center, Tahrir Street, PO 12622, Dokki, Cairo, Egypt. mkawady@yahoo.com
Telephone: +2-2-3362609 Fax: +2-2-3370931
Received: November 2, 2005 Revised: December 26, 2005 Accepted: January 14, 2006 Published online: April 28, 2006
Abstract
AIM: To analyze the neutralizing activity of antibodies against E1 region of hepatitis C virus (HCV). Specific polyclonal antibody was raised via immunization of New Zealand rabbits with a synthetic peptide that had been derived from the E1 region of HCV and was shown to be highly conserved among HCV published genotypes.
METHODS: Hyper-immune HCV E1 antibodies were incubated over night at 4 °C with serum samples positive for HCV RNA, with viral loads ranging from 615 to 3.2 million IU/ mL. Treated sera were incubated with HepG2 cells for 90 min. Blocking of viral binding and entry into cells by anti E1 antibody were tested by means of RT-PCR and flow cytometry.
RESULTS: Direct immunostaining using FITC conjugated E1 antibody followed by Flow cytometric analysis showed reduced mean fluorescence intensity in samples pre-incubated with E1 antibody compared with untreated samples. Furthermore, 13 out of 18 positive sera (72%) showed complete inhibition of infectivity as detected by RT-PCR.
CONCLUSION: In house produced E1 antibody, blocks binding and entry of HCV virion infection to target cells suggesting the involvement of this epitope in virus binding and entry. Isolation of these antibodies that block virus attachment to human cells are useful as therapeutic reagents.
Hepatitis C virus (HCV) is the major etiology of non-A, non-B hepatitis that infects 170 million people worldwide. Approximately 70% to 80% of HCV patients develop chronic hepatitis, 20% to 30% of which progress to liver cirrhosis[1]. At present, there is no vaccine available to prevent HCV infection, and current therapies are not optimal. The initial steps of HCV infection (binding and entry) that are critical for tissue tropism, and hence pathogenesis, are poorly understood. Studies to elucidate this process have been hampered by the lack of robust cell culture systems or convenient small animal models that can support HCV infection. HCV is an enveloped, positive-stranded RNA virus that belongs to the Flaviviridae family. Based on the sequence heterogeneity of the genome, HCV is classified into six major genotypes and 100 subtypes[1]. The viral genome (9.6 kb) is translated into a single poly-protein of 3 000 amino acids (aa). A combination of host and viral proteases are involved in poly-protein processing to give at least nine different proteins[2]. Like other enveloped viruses, E1 and E2 proteins most likely play a pivotal role in the assembly of infectious particle and in the initiation of viral infection by binding to its cellular receptor(s). It has been suggested that the humoral and cellular immune responses to the E1 envelope protein are largely impaired in patients with chronic active hepatitis C, and that such responses may be important for clearance of HCV[3]. Leroux-Roels et al,[4] have previously reported that cellular immune responses to the E1 envelope protein are almost absent in patients with chronic active hepatitis C, while long-term responders to IFN- therapy, on average, show higher levels of E1 antibodies[5]. Depraetere et al,[6] suggesting that E1 antibodies contribute, at least partially, in viral elimination. Baumert et al[7] confirmed the presence of such higher antibody levels directed at the HCV envelope in sustained viral responders to IFN-based therapy. Maertens et al[8] have been able to show that therapeutic vaccination of chronically infected chimpanzees with the HCV E1 protein induces the appearance of T-helper immune responses and antibodies which are very rarely seen in patients[6,7] or chimpanzees[9] with chronic active hepatitis C. The use of a viral envelope protein has the advantage of potentially inducing not only T-cell responses, but also neutralizing antibodies and complement activation. The E1 protein was chosen as vaccine rather than the E2 protein not only because E2 has the disadvantage of displaying a very high strain-to-strain variation in the hypervariable region I (HVRI), but also because of the higher degree of inter-genotype cross-reactivity of E1 as compared to E2. The E2 hypervariable region is immunodominant and neutralizable[10]. However, strong anti-E2 vaccine responses directed against the HVR I do not cross-neutralize with the infecting strain[11,12]. Although the E1 antigen is also variable between genotypes, it shows a relatively high degree of conservation within the subtypes, such as subtype 1b[13], the most widespread genotype worldwide. In the present study, we aimed to examine the neutralizing -related activity of an in house made antibody against the most conserved region of HCV E1 protein, for blocking the entry of HCV virion to HepG2 cells.
MATERIALS AND METHODS
Infected Serum samples
We selected 28 serum samples which tested positive for HCV RNA at different viral loads (ranging from 615 to 3.2 million IU/ mL) for infection experiments. The presence of HCV RNA was determined by nested RT-PCR and genotyped using Innolipa system (Bayer, Germany). Viral loads were determined by branched DNA method (Bayer, Germany).
Design of E1 conserved synthetic peptides
Sequence analysis of HCV quasi-species in local patients (Data not shown), revealed several conserved regions within the core and the E1 proteins. We designed 4 core and one E1-specific peptides and analyzed their ability to detect circulating antibodies in infected patients. The results of these studies showed that only one core-peptide (C1) had reasonable sensitivity and specificity. However the rest of peptides including E1 peptide had poor reactivity with circulating antibodies[14]. In the present study, we raised HCV specific polyclonal antibodies against the 4 core and an E1 peptide as follows:
Production of polyclonal antibodies against core and Envelope regions of HCV
New Zealand rabbits were immunized independently (two rabbits per each peptide) with purified synthetic peptides coupled with KLH protein. Equal volume of diluted core and E1 synthetic peptides and Freund’s complete adjuvant were emulsified and injected subcutaneously into the rabbits in three different sites. On d 15 and 28, the rabbits were immunized again with the same protein emulsified with Incomplete Freund`s adjuvant. On d 32 the rabbits were sacrificed and sera were separated and stored at -20 °C. For direct immuno-fluorescence, immunized polyclonal antibodies were digested with pepsin A (porcine 1:60 000 grade (sigma P-7012) ST. Louis, Mo, USA) at acidic pH and the F(ab)2 portion was labeled with fluorescence isothiocyanate-FITC according to Hudson and Hay[15].
Flow cytometric analysis of E1 binding to HepG2 cells
The interaction of E1 glycoprotein with cells was quantified using a fluorescence activated cell sorting (FACS) based assay. Surface labeling was performed by direct immuno-fluorescence. Twenty eight serum samples that tested positive for HCV RNA with broad range of viral loads (617-3.2 × 106 IU / mL) were incubated with anti E1 antibody (diluted 1:250 in cultured media) overnight at 4 °C. The pretreated sera with E1 antibody were incubated with HepG2 cells for 90 min at 37 °C in CO2 incubator. Cells were centrifugated and supernatants were removed. Cell pellets were washed 4 times with PBS and incubated with FITC labeled F(ab)2 portion of HCV E1 antibody (at 1:1500 dilution) for 30 min at 4 °C. Cells were washed 3 times with PBS containing 1% normal goat serum. Cells were suspended in 500 μL PBS and analyzed with flow cytometry (FACS Calibure, BD). The mean fluorescence intensity were determined using cell Quest software (Becton Dickinson)
Isolation and extraction of RNA from serum and HepG2 cells
RNA was isolated from serum samples and HepG2 cells as reported by Lohr et al[16]. Briefly, cells were precipitated and washed in the same buffer to remove adherent viral particles before lysis in 4 mol/L guanidinium isothiocyanate containing 25 mmol/L sodium citrate, 0.5% sarcosyl and 0.1 mol/L β-mercaptoethanol. Cellular RNA was extracted using the single-step method described originally by Chomczynski and Sacchi[17].
PCR of genomic RNA strands of HCV
Reverse transcription-nested PCR was carried out according to Lohr et al.[16] with few modifications. Retro-transcription was performed in 25 μL reaction mixture containing 20 units of AMV reverse transcriptase (Clonetech, USA) with either 400 ng of total PBMCs RNA or 3 μL of purified RNA from serum samples (equivalent to 30 μL serum) as template, 40 units of RNAsin (Clontech, USA), a final concentration of 0.2 mmol/L from each dNTP (Promega, Madison, WI, USA) and 50 pmol of the reverse primer P1 (for plus strand) or 50 pmol of the forward primer P2 (for minus strand). The reaction was incubated at 42 °C for 60 min. and denatured at 98 °C for 10 min. Amplification of the highly conserved 5’-UTR sequences was done using two rounds of PCR with 2 pairs of nested primers. First round amplification was done in 50 μL reaction containing 50 pmol from each of P2 forward primer and P3 reverse primer, 0.2 mmol/L from each dNTP, 10 µL from RT reaction mixture as template and 2 units of Taq DNA polymerase (Promega, USA) in 1X buffer supplied with the enzyme. The thermal cycling protocol was as follows: 1 min. at 94 °C, 1 min at 55 °C and 1 min at 72 °C for 30 cycles. The second round amplification was done similar to the first round, except for use of the nested reverse primer P4 and forward primer P5 at 50 pmol each. A fragment of 172 bp was identified in positive samples. Primer sequences were as follows: P1: 5’ ggtgcacggtctacgagacctc 3’ P2 : 5’ aactactgtcttcacgcagaa 3’, P3: 5’ tgctcatggtgcacggtcta 3’, P4: 5’ actcggctagcagtctcgcg 3’, P5: 5’ gtgcagcctccaggaccc 3’. To control for false detection of negative-strand HCV RNA and known variations in PCR efficiency[18,19], specific control assays and rigorous standardization of the reaction were employed as previously described[20]. These specific control assays were: (1) cDNA synthesis without RNA templates to exclude product contamination, (2) cDNA synthesis without RTase to exclude Taq polymerase RTase activity, (3) cDNA synthesis and PCR step done with only the reverse or forward primer to confirm no contamination from mixed primers. These controls were consistently negative. In addition, cDNA synthesis was carried out using only one primer followed by heat inactivation of RTase activity at 95 °C for 1 h, in an attempt to diminish false detection of negative-strand prior to the addition of the second primer.
Infection of HepG2 cells with HCV
Cells were grown for 48h to semi-confluence in complete DMEM medium, washed twice with FCS -free medium then inoculated with serum samples (500 µLl plus 500 µL FCS-free DMEM/3 × 106 cells) obtained from HCV infected patients (RT-PCR and antibody positives). The viral load in the used sera was quantitated by bDNA technology and the average copy number was 615-3.2 × 106 IU/mL. After 90 min, DMEM containing FCS was added to make the overall serum contents 10% in a final volume 8 mL including the volume of human serum used for infection and cells were maintained overnight at 37 °C in 50 mL/L CO2. Next day, adherent cells were washed three times with culture medium to get rid of the remaining infectious serum and incubation was continued in complete medium containing 10% FCS with regular medium changes. An inhibition assay of viral absorption or attachment to presumed susceptible cells has been developed for assessing the neutralizing related capacity of antibodies[21]. To analyze the neutralizing-related activity of antibodies against E1 region of HCV as compared with antibodies against core peptides, serial dilutions of serum samples were incubated with equal volumes of different amounts of the studied specific polyclonal antibodies in PBS at 4 °C overnight. One hundred microliters of pretreated serum samples were incubated with 1 mL of the cell suspension of HepG2 cells containing 0.5 million cells. Appropriate controls included HCV RNA positive sera that have neither been treated with E1 nor with core antibodies as positive controls, HepG2 cells not infected with HCV RNA positive sera as negative controls. Retrotranscription-PCR was performed on intracellular HCV RNA of HepG2 cells under the above described circumstances.
RESULTS
Selection of highly conserved peptide sequence among various HCV genotypes
The most conserved 10 amino acid stretch within the N-terminal region of E1 protein derived from several reported HCV isolates is shown in Figure 1. When this 10mer peptide (GHRMAWDMM) was synthesized and used for immunization of New Zealand rabbits, the reactivity of hyper-immune E1 antibody was confirmed by enzyme-linked immunosorbent assay (ELISA) and western blot for detection of E1 protein in infected sera and infected HepG2 cells (Data not shown).
Figure 1 Sequence alignment of amino acids no 311 to 370 ( numbering starts from initiating methionin in the core protein of genotype 4a) of HCV E1 among representative genotypes.
Eight sequences of different subtypes were aligned using ClustalW software, the output diagram is shown with the legend on the left having the accession number and the subtypes. Sequences shown in bold represent the highly conserved amino acid stretch (GHRMAWDMM) used for production of polyclonal antibody.
Selection of HCV positive sera and infection of HepG2 cells
Twenty eight HCV RNA positive sera with different viral loads and various subtypes of genotype 4 were used for infection experiments (Table 1). Only 18 samples were able to infect HepG2 cells, thus producing 18 different cell lines of HCV infected HepG2 cells.
Table 1 Neutralizing activity of E1 antibody on infectivity of HCV to HepG2 cells.
Inhibition of HCV entry into HepG2 cells by specific E1 antibodies
Although an in vitro culture for HCV is not available, an inhibition assay of viral absorption or attachment to presumed susceptible cells has been developed by another laboratory for assessing the neutralizing related capacity of antibodies[21]. In the present study we used the HepG2 cell line to examine the biological function of E1 antibody. All 18 serum samples were positive for HCV RNA and have the ability to infect HepG2 cells as determined by PCR (Figure 2). After incubation of serum samples with E1 antibodies overnight at 4 °C, only 5 out of 18 samples remained infectious to HepG2 cells while the remaining 13 samples did not infect HepG2 cells with an inhibition rate of 72% (Figure 2)
Figure 2 Inhibition of HCV entry into HepG2 cells by anti E1 Ab.
Sera from 6 HCV infected patients (A to F) were used for infection of HepG2 cells before (Lanes 1,3,6,7,9 and 11) and after pre-incubation with anti E1 Ab (Lanes 2,4,6,8,10 and 12). RNA was detected in HepG2 lysates by nested HCV RT-PCR and the products were resolved on 2% agarose gel as described in materials and methods. The presence of a 174 bp band indicates presence of viral RNA while absence of the band indicates successful blocking of viral entry into cells. Lane M shows φx Hae III digest as a molecular weight marker, lane 13 shows RT-PCR of the PBS used for the last wash step of the cells.
Inhibition of HCV binding to HepG2 cells by specific E1 antibodies
The mean fluorescence intensity of bound HCV particle was determined by flow cytometric analysis of HepG2 cells incubated with FITC labeled F(ab)2 portion of HCV E1 antibody after subtraction of the nonspecific fluorescence value. Figure 3 showed a 6 fold ( from 12% to 2%) reduction of mean fluorescence intensity in HepG2 cells treated with serum samples pre-incubated with specific anti E1 antibodies compared with cells incubated with untreated positive sera.
Figure 3 Neutralization of HCV infection into HepG2 cells by anti E1 antibody.
The pretreated sera with anti E1 Ab or with PBS were incubated with HepG2 cells for 90 min at 37 oC in CO2 incubator. Cell pellets were washed with PBS, incubated with FITC labeled F(ab)2 portion of anti E1 Ab and analyzed with flow cytometry as described in Materials and Methods The mean fluorescence intensities decreased from 12.5% in cells incubated with PBS to 2% after treatment with anti E1 Ab using cell Quest software (Becton Dickinson).
DISCUSSION
Although a detailed analysis of the viral genomic organization has led to the identification of various genetic elements[2] and the establishment of subgenomic replicons[22] in transfection experiments, the study of whole viral entry and infection is still hampered by the inability to propagate the virus efficiently in cultured cells and the limited animal tropism of the virus. The chimpanzee is the only nonhuman host serving as a model for HCV infection[23]. Binding of individually expressed recombinant glycoprotein E2 to human cell lines has been used as a surrogate model for binding of virus to host cells, allowing the study of antibody mediated neutralization of binding[24]. Using this surrogate assay, Pileri et al[25] have demonstrated that envelope glycoprotein E2 interacts with the large extracellular loop of cellular membrane protein CD81, a member of the tetraspanin family[26]. CD81 has been suggested as a candidate receptor for HCV[27]. Recently Brazzoli et al[28] suggested that productive folding of the major HCV spike protein E2 is assisted by E1. In the present study ,we developed, in house, a monospecific polyclonal antibody for an E1 peptide. The observed great homology within the N-terminal region of E1 suggests that this domain plays a major role in E1/E2 interaction and proper folding of envelop glycoproteins[29,30]. Therefore, a monospecific antibody against the amino terminal domain of E1 protein was expected to interfere with virus binding to membrane receptor. The immunogenicity of this anti E1 Ab was demonstrated by our laboratory in immunoassay techniques such as flow cytometry for detection of E1 glycoprotein in infected cells[31]. In vitro infection experiments, rather than the artificial replicon assays, was reported by others to mimic the intracellular events occurring in vivo[32,33]. Besides, study of the E1 Ab activity in blocking infection of cells by several infected sera is easier to accomplish via direct infection than the use of the laborious cloning to produce replicon (s) from each sample. However direct infection experiments does not facilitate 100% efficiency of HCV infection into HepG2 cells in all studied cases. In the current study, only 18 out of 28 positive samples (64%) had the ability to infect HepG2 cells as determined by intracellular detection of HCV RNA by RT-PCR. The reasons for the inability of the other ten serum samples to infect HepG2 cells is not clear. The quasispecies pool in each sample seems to play a significant role in determining viral entry in each case[34,35], Moreover, the competitive binding of viral particles and low density lipoproteins (LDL) toward the limited number of LDL receptors on cell membrane contributes in the sample to sample variation probably due to individual variations in LDL levels. Enjoji et al[36] reported that LDL competitively inhibit the infection of hepatocytes with HCV. On the other hand, our results showed that variations in viral counts appear not to be involved in determining the efficiency of HCV entry into HepG2 cells, a finding that agrees with earlier reports[37]. Anti E1 Ab could completely inhibit entry of viral particles into cells in 13 out of 18 (72%) samples. The reasons why the remaining 5 cases (28%) escaped the inhibitory effect of anti E1 Ab may be related to the relative protection of circulating viral particles by exosomes against neutralizing antibodies[38]. Alternatively, the concentration of E1 antibody may be not sufficient for complete inhibition of binding in all tested samples due to variations in the levels of circulating free E1 antigen.
The results of RT-PCR in HepG2 cells were confirmed by the results of flow cytometry. The direct immuno-staining of E1 antibody conjugated with FITC and flow cytometric analysis showed reduced mean fluorescence intensity in the samples pre-incubated with E1 Ab compared with samples without E1 Ab. Shimizu et al[39] and Farci et al[11] demonstrated that a rabbit hyper-immune serum prepared against a peptide representing the 21 C-terminal amino acids of the HVR1 H77 of HCV 1a could neutralize the homologous virus in vitro and in vivo. These studies provided the first identification of a neutralization epitope on the surface of HCV. They also demonstrated that the neutralization was highly strain-specific and that minor variants of HCV bearing divergent sequences in the HVR1 were not neutralized and emerged in the cell culture and the chimpanzee as neutralization escape mutants. The development of a vaccine against HCV, based on stimulating neutralizing antibody to the HVR1, appeared to be a daunting task[40]. In the present study we provide alternative approach which may bear new hope for developing HCV vaccine based on conserved N-terminal region of E1 protein. Recently, Leroux-Roels et al[41] suggested that immunization of healthy individuals against HCV with the E1 protein as a prophylactic vaccine may not only raise useful (potentially neutralizing) anti-E1 antibodies but could also induce a strong T-cell response that might contribute to the prevention of chronic evolution in cases of acute hepatitis C.
In conclusion, in house produced anti E1 Ab that was raised in rabbits against the most conserved region among reported viral strains, blocks HCV infection to target cells suggesting the involvement of this epitope in virus binding and entry. Isolation of similar humanized antibodies that block virus binding and entry will be useful in providing potential therapeutic reagents and for vaccine development.
Depraetere S, Leroux-Roels G. Hepatitis C virus envelope proteins: immunogenicity in humans and their role in diagnosis and vaccine development.Viral Hepat Rev. 1999;5:113-146.
[PubMed] [DOI]
Leroux-Roels G, Esquivel CA, DeLeys R, Stuyver L, Elewaut A, Philippé J, Desombere I, Paradijs J, Maertens G. Lymphoproliferative responses to hepatitis C virus core, E1, E2, and NS3 in patients with chronic hepatitis C infection treated with interferon alfa.Hepatology. 1996;23:8-16.
[RCA] [PubMed] [DOI] [Full Text][Cited by in Crossref: 48][Cited by in RCA: 46][Article Influence: 1.5][Reference Citation Analysis (0)]
Depraetere S, Van Kerschaever E, Van Vlierberghe H, Elewaut A, Brouwer JT, Niesters HG, Schalm SW, Maertens G, Leroux-Roels G. Long term response to interferon treatment in chronic hepatitis C patients is associated with a significant reduction in anti-E1 envelope antibody titers.J Med Virol. 2000;60:126-132.
[RCA] [PubMed] [DOI] [Full Text][Cited by in RCA: 1][Reference Citation Analysis (0)]
Maertens G, Ducatteeuw A, Van Eerd P. Therapeutic vaccination of chronically infected chimpanzees with the HCV E1 protein.Hepatology. 1998;28:398A.
[PubMed] [DOI]
van Doorn LJ, van Hoek K, de Martinoff G, Bosman F, Stuyver L, Kos T, Frantzen I, Sillekens P, Maertens G, Quint W. Serological and molecular analysis of hepatitis C virus envelope regions 1 and 2 during acute and chronic infections in chimpanzees.J Med Virol. 1997;52:441-450.
[PubMed] [DOI] [Full Text]
Seipp S, Mueller HM, Pfaff E, Stremmel W, Theilmann L, Goeser T. Establishment of persistent hepatitis C virus infection and replication in vitro.J Gen Virol. 1997;78:2467-2476.
[PubMed] [DOI]
Enjoji M, Nakamuta M, Kinukawa N, Sugimoto R, Noguchi K, Tsuruta S, Iwao M, Kotoh K, Iwamoto H, Nawata H. Beta-lipoproteins influence the serum level of hepatitis C virus.Med Sci Monit. 2000;6:841-844.
[PubMed] [DOI]
Rumin S, Berthillon P, Tanaka E, Kiyosawa K, Trabaud MA, Bizollon T, Gouillat C, Gripon P, Guguen-Guillouzo C, Inchauspé G. Dynamic analysis of hepatitis C virus replication and quasispecies selection in long-term cultures of adult human hepatocytes infected in vitro.J Gen Virol. 1999;80:3007-3018.
[PubMed] [DOI]
Puntoriero G, Meola A, Lahm A, Zucchelli S, Ercole BB, Tafi R, Pezzanera M, Mondelli MU, Cortese R, Tramontano A. Towards a solution for hepatitis C virus hypervariability: mimotopes of the hypervariable region 1 can induce antibodies cross-reacting with a large number of viral variants.EMBO J. 1998;17:3521-3533.
[RCA] [PubMed] [DOI] [Full Text][Cited by in Crossref: 115][Cited by in RCA: 110][Article Influence: 3.9][Reference Citation Analysis (0)]