BPG is committed to discovery and dissemination of knowledge
Esophageal Cancer Open Access
©2006 Baishideng Publishing Group Co., Limited. All rights reserved.
World J Gastroenterol. Apr 7, 2006; 12(13): 2006-2010
Published online Apr 7, 2006. doi: 10.3748/wjg.v12.i13.2006
Expression of midkine and its clinical significance in esophageal squamous cell carcinoma
Ying-Jia Ren, Qing-Yun Zhang, Department of Immunology, The School of Oncology, Peking University; Beijing Institute for Cancer Research, Beijing 100036, China
Qing-Yun Zhang, Department of Medical Laboratory, Beijing Cancer Hospital, Beijing, 100036, China
Author contributions: All authors contributed equally to the work.
Supported by Beijing Science and Technology Committee Molecular Oncology Laboratory Fund (No. 953850500); National Key Basic Research and Development Project 973 Fund, No. 2004CB518708
Correspondence to: Qing-Yun Zhang, Department of Medical Laboratory, Beijing Cancer Hospital, 52 Fucheng Road, Beijing 100036, China. qingyzhang@btamail.net.cn
Telephone: +86-10-88115736 Fax: +86-10-88122437
Received: August 2, 2005
Revised: December 5, 2005
Accepted: December 15, 2005
Published online: April 7, 2006

Abstract

AIM: To investigate the expression of midkine in eso-phageal squamous cell carcinoma (ESCC) and analyze its relationship with clinicopathological features.

METHODS: RT-PCR and immunocytochemical staining were used to detect the expression of midkine mRNA and protein in EC109 cells, respectively. Then the expression of midkine in 66 cases of ESCC samples were detected by immunohistochemistry using monoclonal antibodies against human midkine.

RESULTS: Midkine was expressed in EC109 cell by RT-PCR and immunocytochemistry. The immunoreactivity was detected in 56.1 % (37/66) of the ESCC samples. The expression of midkine was found in cytoplasm of tumor cells. Notably, the intensity of midkine was stronger at the area abundant in vessels and the in-vading border of the tumors. Midkine was more in-tensely expressed in well differentiated tumors (76.9 %) than in moderately and poorly differentiated tumors (43.1 % and 41.2 %, respectively) (P < 0.05). There was no statistically significant correlation between midkine expression and gender, age, clinical stage, lymph node metastasis or survival in ESCC.

CONCLUSION: Midkine is overexpressed in ESCC. It may play a role in tumor angiogenesis and invasion. The expression of midkine is correlated with tumor cell differentiation in ESCC. The more poorly tumor cells differentiate, the weaker midkine expresses.

Key Words: Midkine; Esophageal squamous cell carcinoma; Expression



INTRODUCTION

Midkine is a novel heparin-binding growth factor, ori-ginally identified as the product of a retinoic acid-respon-sive gene. Midkine and pleiotrophin (PTN; also called HB-GAM) are the only members of a family distinct from other heparin-binding growth factor families[1,2]. In the last few years, midkine has been found to be over-expressed in various human malignant tumors, such as esophageal[3-5], gastric[4,5], colorectal[4-6], liver[4,7,8], lung[9], thyroid[10], urinary bladder[11] and prostate carcinomas[12], as well as neuroblastomas[13] and astrocytomas[14,15]. Especially in neuroblasmas[13] and bladder carcinomas[11], the level of midkine expression correlates negatively with the patients’ prognosis. Furthermore, it has also been reported that midkine is extensively expressed in the early stages of carcinogenesis[6,12]. All of these studies suggested that midkine may play an important role in carcinogenesis, development and metastasis of tumors, and that it could serve as a novel tumor marker.

In the present study, we investigated midkine expression in esophageal squamous cell carcinoma (ESCC). First, we detected midkine mRNA and midkine protein expression in EC109 cells (a cell line of well differentiated human esophageal squamous cell carcinoma) by means of RT-PCR and immunochemical staining, respectively. Then we examined midkine expression in 66 cases of ESCC tissues by immunohistochemical staining using monoclonal antibody against human midkine, and anal-yzed the correlation between midkine expression and clinicopathological features.

MATERIALS AND METHODS
Cell lines

EC109 cells, a well differentiated human ESCC cell line, es-

tablished by National Laboratory of Molecular Onc-ology, Cancer Institute and Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College in 1976, and generously supplied by Department of Immunology, the School of Oncology, Peking University, were maintained in RPMI1640 with 100 mL/L heat-inactivated fetal bovine serum in humidified 50 mL/L CO2 atmosphere at 37 °C.

RT-PCR

Total RNA was extracted from EC109 cells with a sing-le method using the Trizol reagent according to the manufacturer’s protocol. Complementary DNA (cDNA) of EC109 cells was synthesized from 5 μg of total RNA using M-MLV reverse transcriptase. PCR was performed in a total of 20 μL reaction mixture, comprising Taq DNA polymerase, dNTPs, buffer, 10 μmol/L of each gene-specific forward and backward primers and 2 μL of cDNA. β-actin mRNA levels were used as internal controls. The sequences of PCR primers are as follows: for midkine, 5’ AAAGAATTCGAGATGCAGCACCGAGG 3’ (forward) and 5’ AAACTCGAGCCAGGCTTGGCGTCTAGTC3’ (backward); for β-actin, 5’ AACTGGGACGACATGGAGAA 3’ (forward) and 5’ GGTAGTCAGTCAGGTCCC3’ (backward). Expected RT-PCR product sizes were 477 bp for mi-dkine and 318 bp for β-actin. PCR conditions consisted of an initial denaturation step for 5 min at 94 °C, followed by 35 cycles of amplification (denaturation for 30 s at 94 °C, annealing for 30 s at 62.5 °C, and extension for 30 s at 72 °C) and a final extension for 10 min at 72 °C. Then 7 μL of PCR product was electrophoresed on 15 g/L agarose gels to visualize cDNA products.

Immunocytochemical staining of EC109 cells

Dako EnVision system was used for imm-unocytochemical staining of midkine. EC109 cells were fixed with acetone/methanol (1∶1, V/V). Endogenous peroxidase activity was blocked by incubating the sections with 30 mL/L hydrogen peroxide for 10 min at room temperature. After washed with PBS, the slides were blocked with 50 mL/L horse serum for 1 h at 37 °C, followed by incubation with mouse anti-human midkine antibody overnight at 4 °C. After washed with PBS, the slides were incubated with EnVision for 1.5 h at 37 °C and then further washed for 3 times with PBS. After that the sections were reacted with DAB for 5 to 7 min to allow visualization. Finally, the slides were counterstained with hematoxylin, dehydrated, and evaluated under a light microscope.

Patients

Sixty-six specimens of ESCC were obtained from patients who underwent surgery at Beijing Cancer Hospital from Aug. 1998 to Dec. 2000. None of the patients received chemo- or radiotherapy prior to resection. These patients included 56 males and 10 females, aged from 38 to 76 years with a median age of 57.5 years. All the cases had been pathologically proven to be ESCC, including 26 well, 23 moderately and 17 poorly differentiated tumors; and 35 metastatic lymph node specimens.

Immunohistochemical staining of tumor tissues

Mouse monoclonal antibody against human midkine was prepared by our laboratory[16]. Secondary antibody of EnVision kit was purchased from Dako Inc. The sections were stained using standard EnVision, peroxidase method. Four-micrometer-thick tissue sections were dewaxed with xylene and rehydrated with graded ethanol, then briefly immersed in water. Endogenous peroxidase activity was blocked by incubating the sections with 30 mL/L hydrogen peroxide for 10 min at room temperature. Then heat-mediated antigen retrieval was performed by heating the sections (immersed in 0.01 mol/L citrate buffer, pH 6.0) in a microwave oven for 10 min. After washed with PBS, the slides were blocked with 50 mL/L milk to prevent nonspecific binding for 1 h at 37 °C, followed by incubation with mouse anti-human midkine antibody overnight at 4 °C. After washed with PBS, the slides were incubated with EnVision for 1.5 h at 37 °C and then further washed for 3 times with PBS. Finally, the sections were reacted with DAB for 5 to 7 min to allow visualization, and counterstained with hematoxylin, dehydrated, and evaluated under a light microscope. The sections known to be midkine positive were stained under the same conditions as above and served as positive controls. For negative controls, sections were processed as above but the primary antibody was replaced by PBS. Anti-midkine immunoreactivity was confined primarily to the cytoplasm. One hundred cells from 5 randomly selected representative fields (× 400) of each section were counted. It was consid-ered positive when all immunoreactivity levels were more than 10 % with anti-midkine antibody.

Statistical analysis

The χ2 test was used to examine the differences of mi-dkine expression between groups, and Cox regression was employed to analyze the correlation between midkine expression and patients’ post-operation survival time by SPSS 11.0 software. P < 0.05 was considered as statistically significant.

RESULTS
Midkine expression in EC109 cells

Midkine mRNA transcription was detected in EC109 cells by means of RT-PCR (Figure 1). After amplification of RT-PCR, we observed that there were two strands located in the gaps from 400 bp to 500 bp and from 300 bp to 400 bp, respectively. The sizes of RT-PCR product indicated by strands were conformed with expected RT-PCR product sizes of 477 bp for midkine and 318 bp for β-actin. The positive signals of midkine protein immunocytochemical staining were located in cytoplasm. Expression of midkine protein was observed in EC109 cells (Figure 2).

Figure 1
Figure 1 Amplification of midkine mRNA in EC109 cells by RT-PCR.
Figure 2
Figure 2 Midkine expression in EC109 cells (Immunoperoxidase method ×400). A: Positive in EC109 cells; B: Negative control.
Expression of midkine protein in ESCC tissues

Midkine expression was confined primarily to the cytop-lasm, shown as brown granules (Figure 3A). Midkine was expressed in 37 of 66 ESCCs (56.1 %), while it was present at a very low level in just a few normal esophageal epithelia adjacent to tumor tissues. Midkine positive tumor cells were distributed in foci, and the intensity of midkine was stronger at the area abundant in vessels and the invading border of tumors (Figure 3B). In addition, Midkine ex-pression was also found in epithelial cells and smooth muscle cells of vessels in tumor stromal elements.

Figure 3
Figure 3 Midkine expression in ESCC (Immunoperoxidase method). A: In cytoplasm (×400); B: Stronger at the area abundant in vessels (×200).
Correlation between midkine protein expression and clinicopathological features

Midkine was expressed in 20 of 26 well differentiated ESCCs

(76.9 %), more than that in moderately (10/23, 43.1 %) and poorly (7/17, 41.2 %) differentiated tumors (P < 0.05). There was no statistically significant correlation between midkine expression and gender, age, clinical stage, lymph node metastasis or post-operation survival time in ESCC (P > 0.05, Table 1).

Table 1 Intensity of midkine expression in relation to clinico-pathological variables in esophageal squamous cell carcinoma.
VariablenPositivenNegativenPositiverate (%)χ2valuePvalue
GenderMale56312555.40.0740.785
Female106460.0
Age (yr)6035152057.10.0350.851
≥6031171454.8
DifferentiationaWell2620676.97.9060.019
Modertate23101343.5
Poor1771041.2
TNM ClassificationI~II1516769.62.6690.102
III~IV13212248.8
Lymph node metastasisPositive35181751.40.6510.420
Negative31191261.3
DISCUSSION

Many studies have shown that growth factors not only promote tissue proliferation but also induce malignant transformation, and they play important roles in the development of neoplasm[17]. Over-expression of growth factors has been found in many human tumors. Midkine, a novel heparin-binding growth factor, is strongly expressed in mid-gestational period. While in normal adult tissues, its expression is highly restricted. It is normally highly ex-pressed in small bowel epithelium, moderately expressed in the thyroid and lowly expressed in lung, stomach, colon and kidney[18]. In the last few years, Midkine has been found to be over-expressed in various human malignant tumors,such as esophageal[3-5], gastric[4,5], colorectal[4-6], liver[4,7,8], lung[9], thyroid[10], urinary bladder[11] and prostate car-cinomas[12], as well as neuroblastomas[13] and astro-cyto-mas[14,15]. Especially in neuroblasmas[13] and bladder car-cinomas[11], the level of midkine expression correlates negatively with the patients’ prognosis. It has also been reported that midkine is extensively expressed in the early stages of carcinogenesis[6,12]. Further studies showed that midkine had several cancer-related activities. Midkine could transform NIH3T3 cells[19] and enhanced the plasminogen activator/plasmin levels in bovine endothelial cells[20]. It also promotes cell growth[21,22], cell survival[23] and migration of various cells such as neutrophils and macrophages[24]. These biological activities of midkine supported the possible involvement of midkine in carci-nogenesis and tumor advancement.

To further investigate the role of midkine in carcino-genesis and tumor advancement, we examined midkine expression in ESCC. First, we found that midkine was expressed in EC109 cell by means of RT-PCR and immuno-

cytochemistry. Further, we examined midkine expression in 66 ESCC samples using immunohistochemistry. Our data showed that midkine was over-expressed in ESCC with the positive rate of 56.1 % (37/66), while it was present at a very low level in just a few normal esophageal epithelium adjacent to tumor tissues. And the intensity of midkine was stronger at the area abundant in vessels and the invading border of tumors. Midkine expression was also found in epithelial cells and smooth muscle cells of vessels in tumor stromal tissues. These characteristics of distribution were confirmed in Kato’s study[10], suggesting that midkine may play a role in tumor angiogenesis and invasion. It has been demonstrated that midkine could promote the endothelial cells growth and it is a novel molecular mediator in tumor angiogenesis[25].

Our study also showed that the expression of mid-kine was correlated with tumor cell differentiation in ESCC. Midkine was more intensively expressed in well differentiated tumors (76.9 %) than in moderately (43.1 %) and poorly (41.2 %) differentiated tumors (P < 0.05). The phenomenon that the more poorly tumor cells differenti-ated, the weaker midkine was expressed was also observed in other studies on midkine expression in esophageal cancer and vulvar tumors[2,26].

In summary, our study showed that midkine was over-expressed in ESCC. It may play a role in tumor angiogenesis and invasion. The expression of midkine was correlated with tumor cell differentiation in ESCC: the more poorly tumor cells differentiated, the weaker midkine was expressed. Since midkine is a secretory protein, midkine level in blood can be detected when it over-expresses in tumors. It has been reported that an elevated serum midkine level can be detected in many malignant tumors, and serum midkine level decreases after the removal of tumors[27,28].

In addition, the elevated midkine level even can be detected in urine[29]. These studies suggest that midkine could serve as a tumor marker which can be conveniently detected.

References
1.  Tomomura M, Kadomatsu K, Nakamoto M, Muramatsu H, Kondoh H, Imagawa K, Muramatsu T. A retinoic acid responsive gene, MK, produces a secreted protein with heparin binding activity. Biochem Biophys Res Commun. 1990;171:603-609.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 64]  [Cited by in RCA: 70]  [Article Influence: 1.9]  [Reference Citation Analysis (0)]
2.  Kadomatsu K, Tomomura M, Muramatsu T. cDNA cloning and sequencing of a new gene intensely expressed in early differentiation stages of embryonal carcinoma cells and in mid-gestation period of mouse embryogenesis. Biochem Biophys Res Commun. 1988;151:1312-1318.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 397]  [Cited by in RCA: 388]  [Article Influence: 10.2]  [Reference Citation Analysis (1)]
3.  Miyauchi M, Shimada H, Kadomatsu K, Muramatsu T, Matsubara S, Ikematsu S, Takenaga K, Asano T, Ochiai T, Sakiyama S. Frequent expression of midkine gene in esophageal cancer suggests a potential usage of its promoter for suicide gene therapy. Jpn J Cancer Res. 1999;90:469-475.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 26]  [Cited by in RCA: 27]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
4.  Aridome K, Tsutsui J, Takao S, Kadomatsu K, Ozawa M, Aikou T, Muramatsu T. Increased midkine gene expression in human gastrointestinal cancers. Jpn J Cancer Res. 1995;86:655-661.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 124]  [Cited by in RCA: 124]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
5.  Aridome K, Takao S, Kaname T, Kadomatsu K, Natsugoe S, Kijima F, Aikou T, Muramatsu T. Truncated midkine as a marker of diagnosis and detection of nodal metastases in gastrointestinal carcinomas. Br J Cancer. 1998;78:472-477.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 34]  [Cited by in RCA: 35]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
6.  Ye C, Qi M, Fan QW, Ito K, Akiyama S, Kasai Y, Matsuyama M, Muramatsu T, Kadomatsu K. Expression of midkine in the early stage of carcinogenesis in human colorectal cancer. Br J Cancer. 1999;79:179-184.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 71]  [Cited by in RCA: 70]  [Article Influence: 2.6]  [Reference Citation Analysis (1)]
7.  Kato M, Shinozawa T, Kato S, Awaya A, Terada T. Increased midkine expression in hepatocellular carcinoma. Arch Pathol Lab Med. 2000;124:848-852.  [PubMed]  [DOI]
8.  Kato M, Shinozawa T, Kato S, Endo K, Terada T. Increased midkine expression in intrahepatic cholangiocarcinoma: immunohistochemical and in situ hybridization analyses. Liver. 2000;20:216-221.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13]  [Cited by in RCA: 13]  [Article Influence: 0.5]  [Reference Citation Analysis (0)]
9.  Sakitani H, Tsutsumi M, Kadomatsu K, Ikematsu S, Takahama M, Iki K, Tsujiuchi T, Muramatsu T, Sakuma S, Sakaki T. Overexpression of midkine in lung tumors induced by N-nitrosobis(2-hydroxypropyl)amine in rats and its increase with progression. Carcinogenesis. 1999;20:465-469.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 23]  [Cited by in RCA: 20]  [Article Influence: 0.7]  [Reference Citation Analysis (0)]
10.  Kato M, Maeta H, Kato S, Shinozawa T, Terada T. Immunohistochemical and in situ hybridization analyses of midkine expression in thyroid papillary carcinoma. Mod Pathol. 2000;13:1060-1065.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 36]  [Cited by in RCA: 33]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
11.  O'Brien T, Cranston D, Fuggle S, Bicknell R, Harris AL. The angiogenic factor midkine is expressed in bladder cancer, and overexpression correlates with a poor outcome in patients with invasive cancers. Cancer Res. 1996;56:2515-2518.  [PubMed]  [DOI]
12.  Konishi N, Nakamura M, Nakaoka S, Hiasa Y, Cho M, Uemura H, Hirao Y, Muramatsu T, Kadomatsu K. Immunohistochemical analysis of midkine expression in human prostate carcinoma. Oncology. 1999;57:253-257.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 79]  [Cited by in RCA: 71]  [Article Influence: 2.6]  [Reference Citation Analysis (0)]
13.  Nakagawara A, Milbrandt J, Muramatsu T, Deuel TF, Zhao H, Cnaan A, Brodeur GM. Differential expression of pleiotrophin and midkine in advanced neuroblastomas. Cancer Res. 1995;55:1792-1797.  [PubMed]  [DOI]
14.  Mishima K, Asai A, Kadomatsu K, Ino Y, Nomura K, Narita Y, Muramatsu T, Kirino T. Increased expression of midkine during the progression of human astrocytomas. Neurosci Lett. 1997;233:29-32.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 84]  [Cited by in RCA: 80]  [Article Influence: 2.8]  [Reference Citation Analysis (0)]
15.  Kato S, Ishihara K, Shinozawa T, Yamaguchi H, Asano Y, Saito M, Kato M, Terada T, Awaya A, Hirano A. Monoclonal antibody to human midkine reveals increased midkine expression in human brain tumors. J Neuropathol Exp Neurol. 1999;58:430-441.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 22]  [Cited by in RCA: 23]  [Article Influence: 0.9]  [Reference Citation Analysis (0)]
16.  Zhang QY, Yang M, Wang YM, Xu JJ. [Expression of midkine fusion protein and preparation and application of its monoclonal antibodies]. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 2005;21:605-608.  [PubMed]  [DOI]
17.  Aaronson SA. Growth factors and cancer. Science. 1991;254:1146-1153.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 937]  [Cited by in RCA: 841]  [Article Influence: 24.0]  [Reference Citation Analysis (0)]
18.  Kadomatsu K, Huang RP, Suganuma T, Murata F, Muramatsu T. A retinoic acid responsive gene MK found in the teratocarcinoma system is expressed in spatially and temporally controlled manner during mouse embryogenesis. J Cell Biol. 1990;110:607-616.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 193]  [Cited by in RCA: 202]  [Article Influence: 5.6]  [Reference Citation Analysis (0)]
19.  Muramaki M, Miyake H, Hara I, Kamidono S. Introduction of midkine gene into human bladder cancer cells enhances their malignant phenotype but increases their sensitivity to antiangiogenic therapy. Clin Cancer Res. 2003;9:5152-5160.  [PubMed]  [DOI]
20.  Kojima S, Muramatsu H, Amanuma H, Muramatsu T. Midkine enhances fibrinolytic activity of bovine endothelial cells. J Biol Chem. 1995;270:9590-9596.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 86]  [Cited by in RCA: 90]  [Article Influence: 2.9]  [Reference Citation Analysis (0)]
21.  Takei Y, Kadomatsu K, Matsuo S, Itoh H, Nakazawa K, Kubota S, Muramatsu T. Antisense oligodeoxynucleotide targeted to Midkine, a heparin-binding growth factor, suppresses tumorigenicity of mouse rectal carcinoma cells. Cancer Res. 2001;61:8486-8491.  [PubMed]  [DOI]
22.  Takei Y, Kadomatsu K, Yuasa K, Sato W, Muramatsu T. Morpholino antisense oligomer targeting human midkine: its application for cancer therapy. Int J Cancer. 2005;114:490-497.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 29]  [Cited by in RCA: 25]  [Article Influence: 1.2]  [Reference Citation Analysis (0)]
23.  Qi M, Ikematsu S, Ichihara-Tanaka K, Sakuma S, Muramatsu T, Kadomatsu K. Midkine rescues Wilms' tumor cells from cisplatin-induced apoptosis: regulation of Bcl-2 expression by Midkine. J Biochem. 2000;127:269-277.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 79]  [Cited by in RCA: 74]  [Article Influence: 2.8]  [Reference Citation Analysis (0)]
24.  Sato W, Kadomatsu K, Yuzawa Y, Muramatsu H, Hotta N, Matsuo S, Muramatsu T. Midkine is involved in neutrophil infiltration into the tubulointerstitium in ischemic renal injury. J Immunol. 2001;167:3463-3469.  [PubMed]  [DOI]
25.  Beecken WD, Kramer W, Jonas D. New molecular mediators in tumor angiogenesis. J Cell Mol Med. 2000;4:262-269.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 31]  [Cited by in RCA: 26]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
26.  Wu X, Yao J, Li Q, Zheng H, Xin Y. Expression of midkine in benign, premalignant and malignant vulvar tumors. Chin Med Sci J. 2002;17:148-152.  [PubMed]  [DOI]
27.  Ikematsu S, Yano A, Aridome K, Kikuchi M, Kumai H, Nagano H, Okamoto K, Oda M, Sakuma S, Aikou T. Serum midkine levels are increased in patients with various types of carcinomas. Br J Cancer. 2000;83:701-706.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 146]  [Cited by in RCA: 146]  [Article Influence: 5.6]  [Reference Citation Analysis (4)]
28.  Shimada H, Nabeya Y, Tagawa M, Okazumi S, Matsubara H, Kadomatsu K, Muramatsu T, Ikematsu S, Sakuma S, Ochiai T. Preoperative serum midkine concentration is a prognostic marker for esophageal squamous cell carcinoma. Cancer Sci. 2003;94:628-632.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 67]  [Cited by in RCA: 61]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
29.  Ikematsu S, Okamoto K, Yoshida Y, Oda M, Sugano-Nagano H, Ashida K, Kumai H, Kadomatsu K, Muramatsu H, Takashi Muramatsu S. High levels of urinary midkine in various cancer patients. Biochem Biophys Res Commun. 2003;306:329-332.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 26]  [Cited by in RCA: 24]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
Footnotes

S- Editor Guo SY L- Editor Zhu LH E- Editor Wu M

Write to the Help Desk