BPG is committed to discovery and dissemination of knowledge
Brief Reports Open Access
©2005 Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Feb 14, 2005; 11(6): 867-870
Published online Feb 14, 2005. doi: 10.3748/wjg.v11.i6.867
YMDD mutations in patients with chronic hepatitis B untreated with antiviral medicines
Zhong-Min Huang, Qi-Wen Huang, Ya-Qin Qin, Yan-Zhuan He, Hou-Ji Qin, Yiao-Nan Zhou, Xiang Xu, Mei-Jin Huang, Department of Infectious Diseases, The Affiliated Hospital of YouJiang Medical College for Nationalities, Baise 533000, Guangxi Zhuang Autonomous Region, China
Author contributions: All authors contributed equally to the work.
Supported by the Natural Science Foundation of Guangxi Zhuang Autonomous Region, No. 49 (2002)
Correspondence to: Dr. Ya-Qin Qin, Department of Infectious Diseases, The Affiliated Hospital of YouJiang Medical College for Nationalities, Baise 533000, Guangxi Zhuang Autonomous Region, China. zhongminhuang@msn.com
Telephone: +86-776-2836942 Fax: +86-776-2825603
Received: April 30, 2004
Revised: May 2, 2004
Accepted: June 24, 2004
Published online: February 14, 2005

Abstract

AIM: To polymerase P region (YMDD) mutations of hepatitis B virus gene (HBV DNA) in patients with chronic hepatitis B (CHB) untreated with antiviral medicines and to explore its correlation with pre-c-zone mutations, HBV genotypes and HBV DNA level, and to observe its curative effect.

METHODS: A total of 104 cases (38 cases in group of familial aggregation and 66 cases in group of non-familial aggregation) were randomly chosen from 226 patients with CHB who did not receive the treatment of lamivudine (LAM) and any other antivirus drugs within the last one year. Their serum YMDD mutations were detected by microcosmic nucleic acid and cross-nucleic acid quantitative determination, HBV genotypes by PCR-microcosmic nucleic acid cross-ELISA, HBV DNA quantitative determination and fluorescence ration PCR analysis, hepatitis B virus markers (HBVM) by ELISA. LAM was taken by 10 patients with YMDD mutations and its curative effect was observed.

RESULTS: Twenty-eight cases (26.9%) had YMDD mutations, of them 11 cases (28.9%) were in familial aggregation group (38 cases) and 17 cases (25.8%) in non-familial aggregation group (66 cases) with no significant difference between the two groups. Twenty-seven point one percent (16/59) cases were positive for HBeAg YMDD mutations, and 26.7% (12/45) cases were negative for HBeAg and positive for anti-HBe. There was also no significant difference between the two groups. Different YMDD incidence rate existed in different HBV genotypes. HBV DNA level did not have a positive correlation with the incidence of YMDD mutations. LAM was effective for all patients with mutations.

CONCLUSION: Wild mutant strains in HBV and their incidence rate have no significant difference between familial aggregation and non-familial aggregation. It may have no significant relationship between YMDD mutations and pre-c-zone mutations. HBV DNA level may not have a positive correlation with YMDD mutations. LAM is clinically effective for CHB patients with YMDD mutations.

Key Words: Hepatitis B virus; Chronic hepatitis; Genotypes; YMDD mutation; Lamivudine



INTRODUCTION

To investigate the polymerase P region (YMDD) mutations of hepatitis B virus gene (HBV DNA) in patients with CHB who had not received antiviral treatment, 104 cases were randomly chosen from 226 such cases to detect their serum YMDD mutations. To explore its correlation with HBV genotypes, HBV DNA level and HBV e antigen system, and to investigate its incidence rate between familial aggregation and non-familial aggregation. LAM treatment was given to some patients with YMDD mutations. The therapeutic results were analyzed.

MATERIALS AND METHODS
Patients and materials

A total of 104 patients were from out-patient and in-patient departments of our hospital. Among them 38 cases were in familial aggregation group (2 or more close-contacted family members were infected with HBV but had no direct evidence of blood transmission), including 26 males and 12 females aged 17-69 years (average, 35 years). Sixty-six cases were in non-familial aggregation group, including 45 males and 21 females aged 16-56 years (average, 34.6 years). All the cases met the diagnosis standards made at the Tenth Viral Hepatitis Conference[1] and had not received LAM treatment or any other antiviral treatment within one year before detection of serum YMDD.

Detection of YMDD mutations

YMDD mutations of HBV DNA were detected by microc-osmic nucleic acid cross-nucleic acid quantitative determination. The detection of 25 cases was completed at the Biomedicine Diagnosis and Research Center of Basic Medicine Department of the First Military Medical University, and the detection of the other 79 cases was completed under the same conditions at our hospital’s central laboratory. For specimen processing, 50 μL serum to be tested and 50 μL processed liquid were fully mixed, boiled at 100 °C for 5 min, spun by centrifugation at 12 000 r/min for 5 min, and 8 μL supernatant was put into a tube containing reaction liquid, spun by centrifugation for 10 s at 10 000 r/min, then put into the processing machine and pre-denatured at 92 °C for 2 min, followed by 35 cycles (denaturation at 94 °C for 50 s, annealing at 55 °C for 50 s,extension at 72 °C for 65 s) and a final extension at 72 °C for 3 min. For HBV DNA primer design, HBV W1 (TGGACGTCGCATGGGAGAACCACCGTGAA) and HBV W2 (GAAAGCTTCTGCGACGCCGTGATTGAG) were taken as primers of YMDD. For hybridization, amplified products were denatured at 98 °C for 10 min and then cooled in an ice-bath for 10 min. Two hundred micro liters of hybridization liquid was added and kept at 55 °C for 6 min, and the step was repeated twice. One hundred micro liters of enzyme anti-body liquid was added and kept at 37 °C for 30 min, discarded gently and completely, then 200 μL enzyme lotions was added, kept at 37 °C for 5 min, and the step was repeated twice. Color reagents A and B (30 μL) were added, kept at room temperature for 10 min, then 60 μL termination liquid was added and the results were observed. The spatial absorption value (A) was detected with an enzyme labeling machine. YMDD was considered to be positive if P/N ≤3.5.

Detection of HBV genotypes

HBV genotypes were detected by PCR-microcosmic nucleic acid cross-ELISA[2]. Twenty-five cases were completed in Biomedicine Diagnosis and Research Center, Basic Medicine Department of the First Military Medical University, and the other 79 cases were detected in our hospital according to the introduction manual.

Quantitative determination of HBV DNA

Shanghai FX990 micro-fluorometer and HBV-PCR fluoroscopy reagent kits (termination value, 103 copy/mL), provided by the Shanghai Fu Xing Company, were used. The procedure was strictly manipulated according to the introduction manual and estimated by experts.

Detection of HBVM

For the detection of HBVM, ELISA was adopted. Reagent kits were provided by Zhongshan Bioengineering Co. Ltd, Guangdong. The manipulations were strictly completed according to the introduction manual.

Treatment

LAM (10 mg/d p.o.) was given to patients with YMDD mutations and their liver functions, HBVM and HBV DNA were detected every 4 wk and observed continuously for 42 wk.

Statistical analysis

The incidence rate of YMDD mutation was compared by χ2 test between different genotypes, HBV DNA level, HBV e system, familial aggregation and non-familial aggregation case. The statistical analysis was processed with SAS statistical software. P<0.05 was considered significant.

RESULTS
YMDD mutation data of 104 CHB cases

Twenty-eight cases (26.9%) out of 104 had YMDD mutations. The incidence rate of YMDD mutations was 25.8% (17/66) in non-familial aggregation cases, and 28.9% (11/38) in familial aggregation cases. No significant difference could be found between the two groups. (χ2 = 0.124, P>0.05).

Relationship between HBeAg system and YMDD mutations

Of the 59 cases who were positive for HBeAg, 16 had YMDD mutations and the incidence rate was 27.1%. Of the 45 cases who were negative for HBeAg and positive for anti-HBe, 12 cases had YMDD mutations and the incidence rate was 26.7%. There was no significant difference between the two groups (χ2 = 0.0027, P>0.05).

YMDD mutations in different HBV genotypes

Genotypes of all these cases included D, C, B, non-classified types and mixed forms of CD, CB and DB. YMDD mutations of different genotypes are shown in Table 1. It demonstrated that the mutations mostly occurred in genotype C and its mixed genotypes, accounting for 71.4% (20/28).

Table 1 YMDD mutations in different HBV genotypes.
Patterns of genotypesnCase number of YMDD mutationsIncidence rate (%)
CD25832
CB16637.5
C15640
D9222.2
B9--
DB12--
Non-classified types18633.3
Total count1042826.9
Relationship between HBV DNA level and YMDD mutations

There was no significant difference between high and low HBV DNA level groups, suggesting that HBV DNA level might not have a positive correlation with YMDD mutations (Table 2).

Table 2 Comparison of YMDD mutations in different HBV DNA levels.
HBV DNA (copy/mL)nYMDD mutations
PositivePositive rate (%)
≤105561628.6
>105481225
Observation of curative effect

Of the 28 patients with YMDD mutations, 18 gave up treatments because of financial difficulty, the other 10 had abnormal ALT level and were positive for HBeAg at the same time. In the 10 cases, HBV DNA level decreased by different degrees 4 wk after LAM treatment. At the end of 42 wk, HBV DNA level in 8 cases (80%) was lower than 103/mL, and ALT was returned to normal and baseline level of ALT did not rebound. HBeAg converted to negative in 4 (40%) cases and 1 (10%) case had HBeAg/anti-HBe serum conversion. It was suggested that LAM had a good curative effect in the patients with wild YMDD mutations.

DISCUSSION

HBV belongs to DNA viral species and its duplication course is similar to that of reversed transcription viruses. HBV DNA polymerase has an activity of reversed transcription and a highly conservative YMDD order locating in the polymerase structural region C area, which is the combing and functioning site of LAM (nucleoside antiviral medicine). A great number of studies in recent years showed that long-term (longer than 6 mo) LAM treatment could contribute to YMDD mutations[3-12] and disease recurrence. Some patients even went worse, and eventually died [13-17]. But it has been seldom reported whether YMDD mutations have natural existence. Some scholars[18,19] found that YMDD mutational strains were positive in the serum of the cases infected with CHB who did not receive LAM treatment. Yan et al[20] showed that 19 cases had YMDD mutations out of 110 CHB cases untreated with LAM. Fontaine et al[21] reported that 5 had YMDD mutations out of 18 cases of asymptomatic HBV carriers, and so they considered that the natural existence of YMDD mutational strains was associated with a great amount of HBVs existing in CHB patients and its mutations. Fontaine et al[21] revealed that YMDD mutations also occurred in HBV-infected cases who underwent kidney transplantation and dialysis therapy. In addition, Zhang et al[22] found that 32 (26.2%) cases (including wild YMDD genotypes and mutant genotypes) had YMDD mutations in 122 CHB cases by genetic chip determination. Matsuda et al[23] reported that a few CHB cases not treated with LAM had YMDD mutations. Of the 104 CHB cases in this study who had not received LAM and any other Chinese traditional or Western antiviral treatment, 28 (26.9%) had YMDD mutations and the detection rate of mutational strains was in accordance with that reported by Zhang et al[22], showing that wild YMDD mutational strains were in existence in HBV DNA. However, the spontaneous incidence rate of YMDD mutations had no correlation with familial aggregation.

Kobayashi et al[19] found that anti-HBe was positive in all patients with YMDD mutations, and Ye et al[24] found that anti-HBe was positive in most patients with YMDD mutations and considered that YMDD mutations might occur more easily if mutations took place in pre-c-zone. In this study, we found that the incidence rate of YMDD mutations was 27.1% in patients with negative HBeAg while 26.7% in patients with negative HBeAg and positive anti-HBe. There was no significant difference between the two groups. These results do not accord with those of Kobayashi et al[19] and Ye et al[24] but accord with the studies of Da Silva et al[25] and Yan et al[20]. Therefore, YMDD mutations might not have a relationship with pre-c-zone mutations.

We found that there was a difference in the incidence rate of HBV YMDD wild mutational strains between HBV genotypes C, D, non-classified types and mixed genotypes of CD and CB. Most of the mutations (71.4%) occurred in genotype C and its mixed forms partly because genotype C occupied a great proportion in CHB cases. Though there was no significant difference among these genotypes, the relation between YMDD mutations and HBV genotypes could not be excluded as the cases were comparatively small in our study.

Some scholars[26, 27] proposed that a high HBV DNA level of serum had a positive correlation with the incidence of mutations. After HBV DNA was detected in 104 CHB patients, we found 12 YMDD mutations (25.0%) in 48 cases with a higher level of HBV DNA (>105 copies/mL), while 16 (28.6%) mutations were found in 26 cases with a lower HBV DNA level (≤105 copies/mL) and there was no significant difference between the two groups, suggesting that HBV DNA level might not be positively correlated with YMDD mutations. Further studies with more samples should be conducted.

LAM has been acknowledged and identified as one of the first-line medicines for CHB at World Gastroenterology Conference, and by Asian-Pacific Region Hepatology Association and European-American Hepatology Association[28,29]. In our study, 10 patients with YMDD mutations were treated with LAM. We found that HBV DNA level decreased by different degrees 4 wk after treatment, and at the end of 42 wk HBV DNA level in 8 cases was lower than 103 copies/mL, and their ALT recovered to normal and baseline level of ALT did not rebound, HBeAg became negative in 4 cases and l case had HBeAg/anti-HBe conversion. These indicated that LAM had a short-term curative effect on CHB with YMDD mutations. The results might be associated with the fact that wild viral strains were dominant while YMDD mutational strains were minor and had a lower duplication activity and weaker pathogenicity. The samples were small and the course of treatment was not long enough in our study to assess. To know whether and how the curative effect of LAM was affected by YMDD mutational strains, a contoured study with a non-YMDD mutation group and larger sample size is needed. Some scholars[30-34] considered that LAM combined with other antiviral medicines in the treatment of CHB patients would partly improve the curative effect and could delay or decrease the occurrence of drug-tolerant YMDD mutation strains. Thus, it is worthwhile to explore antiviral medicines for the treatment of patients with natural YMDD mutations.

In conclusion, YMDD wild mutational strains exist in HBV and its incidence rate has no relation to familial aggregation. LAM has a good short-term curative effect in CHB patients with YMDD mutations. But some issues still need further research, such as the factors that contribute to mutations, the relationship between mutations and the development of hepatic diseases, the correlation of pre-c-zone mutations with genotypes, the relationship between HBV DNA level and the incidence of mutations.

References
1.  Schemes of prevention and cure for viral hepatitis in hepatology branch-conference of Infectious Diseases and Parasitic Disease Association of Chinese Medical Association Zhonghua Ganzangbing Zazhi. 2000;8:324-329.  [PubMed]  [DOI]
2.  Wang H, Wan CS, Wang SL, Peng HG. Study on genotypes of HBV DNA using PCR microplate hybridization-ELISA. Zhonghua Weishengwuxue He Mianyixue Zazhi. 2001;21:234-236.  [PubMed]  [DOI]
3.  Xu D, Tian DY, Wang WH, Chen HY, Xing MY, Guo W, Song PH. Emergence and clinical significance of YMDD and HBeAg-related mutations during lamivudine treatment. Zhonghua NeiKe ZaZhi. 2004;43:121-124.  [PubMed]  [DOI]
4.  Tsubota A, Arase Y, Suzuki F, Kobayashi M, Matsuda M, Sato J, Suzuki Y, Akuta N, Sezaki H, Hosaka T. Severe acute exacerbation of liver disease may reduce or delay emergence of YMDD motif mutants in long-term lamivudine therapy for hepatitis B e antigen-positive chronic hepatitis B. J Med Virol. 2004;73:7-12.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 11]  [Cited by in RCA: 12]  [Article Influence: 0.5]  [Reference Citation Analysis (0)]
5.  Liaw YF. Results of lamivudine trials in Asia. J Hepatol. 2003;39 Suppl 1:S111-S115.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 54]  [Cited by in RCA: 57]  [Article Influence: 2.6]  [Reference Citation Analysis (0)]
6.  Yao GB, Wang BE, Cui ZY, Yao JL, Zeng MD. The long-term efficacy of lamivudine in chronic hepatitis B: interim analysis of 3-year's clinical course. Zhonghua NeiKe ZaZhi. 2003;42:382-387.  [PubMed]  [DOI]
7.  Song JW, Lin JS, Kong XJ, Liang KH. Clinical study of oligonucleotide microarray on monitoring the lamivudine-resistance mutations in hepatitis B virus. Zhonghua GanZangBing ZaZhi. 2003;11:361-363.  [PubMed]  [DOI]
8.  Liu Z. Individual therapy for the patients with YMDD mutation in HBV by lamivudine. Zhonghua GanZangBing ZaZhi. 2003;11:558.  [PubMed]  [DOI]
9.  Hu YY, Jiang JJ, Li D, Lin CW, Li QG, Chen Y. Evaluation of different methods in monitoring YMDD motif mutations associated with lamivudine resistance. Zhonghua GanZangBing ZaZhi. 2003;11:427-430.  [PubMed]  [DOI]
10.  Bartholomew MM, Jansen RW, Jeffers LJ, Reddy KR, Johnson LC, Bunzendahl H, Condreay LD, Tzakis AG, Schiff ER, Brown NA. Hepatitis-B-virus resistance to lamivudine given for recurrent infection after orthotopic liver transplantation. Lancet. 1997;349:20-22.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 351]  [Cited by in RCA: 334]  [Article Influence: 11.5]  [Reference Citation Analysis (0)]
11.  Yao G, Wang B, Cui Z. Long-term effect of lamivudine treatment in chronic hepatitis B virus infection. Zhonghua GanZangBing ZaZhi. 1999;7:80-83.  [PubMed]  [DOI]
12.  Fu L, Cheng YC. Role of additional mutations outside the YMDD motif of hepatitis B virus polymerase in L(-)SddC (3TC) resistance. Biochem Pharmacol. 1998;55:1567-1572.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 103]  [Cited by in RCA: 101]  [Article Influence: 3.6]  [Reference Citation Analysis (0)]
13.  Ben-Ari Z, Daudi N, Klein A, Sulkes J, Papo O, Mor E, Samra Z, Gadba R, Shouval D, Tur-Kaspa R. Genotypic and phenotypic resistance: longitudinal and sequential analysis of hepatitis B virus polymerase mutations in patients with lamivudine resistance after liver transplantation. Am J Gastroenterol. 2003;98:151-159.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 19]  [Cited by in RCA: 23]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
14.  Ben-Ari Z, Mor E, Tur-Kaspa R. Experience with lamivudine therapy for hepatitis B virus infection before and after liver transplantation, and review of the literature. J Intern Med. 2003;253:544-552.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 22]  [Cited by in RCA: 23]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
15.  Wang JH, Lu SN, Lee CM, Lee JF, Chou YP. Fatal hepatic failure after emergence of the hepatitis B virus mutant during lamivudine therapy in a patient with liver cirrhosis. Scand J Gastroenterol. 2002;37:366-369.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 51]  [Cited by in RCA: 48]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
16.  Ogata N, Ichida T, Aoyagi Y, Kitajima I. Development of peptide nucleic acid mediated polymerase chain reaction clamping (PMPC)--direct sequencing method for detecting lamivudine-resistant hepatitis B virus (HBV) variants with high sensitivity and specificity. Rinsho Byori. 2003;51:313-319.  [PubMed]  [DOI]
17.  Manolakopoulos S, Karatapanis S, Elefsiniotis J, Mathou N, Vlachogiannakos J, Iliadou E, Kougioumtzan A, Economou M, Triantos C, Tzourmakliotis D. Clinical course of lamivudine monotherapy in patients with decompensated cirrhosis due to HBeAg negative chronic HBV infection. Am J Gastroenterol. 2004;99:57-63.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 62]  [Cited by in RCA: 60]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
18.  Kirishima T, Okanoue T, Daimon Y, Itoh Y, Nakamura H, Morita A, Toyama T, Minami M. Detection of YMDD mutant using a novel sensitive method in chronic liver disease type B patients before and during lamivudine treatment. J Hepatol. 2002;37:259-265.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 68]  [Cited by in RCA: 66]  [Article Influence: 2.8]  [Reference Citation Analysis (0)]
19.  Kobayashi S, Ide T, Sata M. Detection of YMDD motif mutations in some lamivudine-untreated asymptomatic hepatitis B virus carriers. J Hepatol. 2001;34:584-586.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 88]  [Cited by in RCA: 91]  [Article Influence: 3.6]  [Reference Citation Analysis (0)]
20.  Yan MH, Zhang C, Ling Q, Zhou RF. Detection of YMDD motif mutations in lamivudine-untreated patients with chronic hepatitis B. Zhonghua GanZangBing ZaZhi. 2003;11:430-431.  [PubMed]  [DOI]
21.  Fontaine H, Thiers V, Chrétien Y, Zylberberg H, Poupon RE, Bréchot C, Legendre C, Kreis H, Pol S. HBV genotypic resistance to lamivudine in kidney recipients and hemodialyzed patients. Transplantation. 2000;69:2090-2094.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 68]  [Cited by in RCA: 56]  [Article Influence: 2.2]  [Reference Citation Analysis (1)]
22.  Zhang XH, Zhang YX, Sun LR, Wen Q, Zhou LQ, Fan GX, Zhang X, Yang DG. Study of gene chips in the detection of YMDD mutations in the region of HBV polymeras. Zhonghua YiXue ZaZhi. 2003;83:459-462.  [PubMed]  [DOI]
23.  Matsuda M, Suzuki F, Suzuki Y, Tsubota A, Akuta N, Hosaka T, Someya T, Kobayashi M, Saitoh S, Arase Y. Low rate of YMDD motif mutations in polymerase gene of hepatitis B virus in chronically infected patients not treated with lamivudine. J Gastroenterol. 2004;39:34-40.  [PubMed]  [DOI]  [Full Text]
24.  Ye XG, Wang RL, Guo HB. Detection and analysis of YMDD mutate genes in patients of chronic hepatitis B before being treated. Zhonghua Jianyan Yixue Zazhi. 2002;25:248.  [PubMed]  [DOI]
25.  Da Silva LC, da Fonseca LE, Carrilho FJ, Alves VA, Sitnik R, Pinho JR. Predictive factors for response to lamivudine in chronic hepatitis B. Rev Inst Med Trop Sao Paulo. 2000;42:189-196.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 15]  [Cited by in RCA: 15]  [Article Influence: 0.6]  [Reference Citation Analysis (0)]
26.  Kobayashi S. Clinical characteristics of asymptomatic hepatitis B virus carriers with YMDD mutant not treated with lamivudine. Kurume Med J. 2003;50:87-90.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4]  [Cited by in RCA: 3]  [Article Influence: 0.1]  [Reference Citation Analysis (0)]
27.  Tassopoulos NC, Volpes R, Pastore G, Heathcote J, Buti M, Goldin RD, Hawley S, Barber J, Condreay L, Gray DF. Efficacy of lamivudine in patients with hepatitis B e antigen-negative/hepatitis B virus DNA-positive (precore mutant) chronic hepatitis B. Lamivudine Precore Mutant Study Group. Hepatology. 1999;29:889-896.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 377]  [Cited by in RCA: 352]  [Article Influence: 13.0]  [Reference Citation Analysis (1)]
28.  Pramoolsinsup C. Management of viral hepatitis B. J Gastroenterol Hepatol. 2002;17 Suppl:S125-S145.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 49]  [Cited by in RCA: 43]  [Article Influence: 1.8]  [Reference Citation Analysis (1)]
29.  Alberti A, Brunetto MR, Colombo M, Craxì A. Recent progress and new trends in the treatment of hepatitis B. J Med Virol. 2002;67:458-462.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 15]  [Cited by in RCA: 14]  [Article Influence: 0.6]  [Reference Citation Analysis (1)]
30.  Wu GX, Zha YS, Zheng J, Wang YZ, Zhou GP. Effect of interferon combined with lamivudine in treatment of chronic hepatitis B patients infected with HBV with mutation of YMDD. Zhonghua GanZangBing ZaZhi. 2003;11:752-753.  [PubMed]  [DOI]
31.  Zhou F, Wang LT, Chen JJ. Therapeutic efficacy of combined application of lamivudine and bushen recipe in treating chronic hepatitis B and its influence on YMDD motif. Zhongguo ZhongXiYi JieHe ZaZhi. 2003;23:417-420.  [PubMed]  [DOI]
32.  Deng H, Zhao ZX, Xu QH, Zhou YP, Chen YM, Yao JL. Therapy effect of lamivudine combination with alpha interferon on patients with chronic hepatitis B. Zhonghua GanZangBing ZaZhi. 2003;11:305-308.  [PubMed]  [DOI]
33.  Schalm SW, Heathcote J, Cianciara J, Farrell G, Sherman M, Willems B, Dhillon A, Moorat A, Barber J, Gray DF. Lamivudine and alpha interferon combination treatment of patients with chronic hepatitis B infection: a randomised trial. Gut. 2000;46:562-568.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 382]  [Cited by in RCA: 359]  [Article Influence: 13.8]  [Reference Citation Analysis (0)]
34.  Perrillo R, Hann HW, Mutimer D, Willems B, Leung N, Lee WM, Moorat A, Gardner S, Woessner M, Bourne E. Adefovir dipivoxil added to ongoing lamivudine in chronic hepatitis B with YMDD mutant hepatitis B virus. Gastroenterology. 2004;126:81-90.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 332]  [Cited by in RCA: 302]  [Article Influence: 13.7]  [Reference Citation Analysis (1)]
Footnotes

Co-first-authors: Ya-Qin Qin and Zhong-Min Huang

Edited by Wang XL and Zhu LH

Write to the Help Desk