BPG is committed to discovery and dissemination of knowledge
Brief Reports Open Access
©The Author(s) 2005. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Aug 28, 2005; 11(32): 5037-5043
Published online Aug 28, 2005. doi: 10.3748/wjg.v11.i32.5037
Gene expression profiles in peripheral blood mononuclear cells of SARS patients
Shi-Yan Yu, Xiao-Ying Liu, Wei Xiong, Zheng-Hong Yuan, Key Laboratory of Medical Molecular Virology, Ministry of Education and Public Health, Shanghai Medical College of Fudan University, Shanghai 200032, China
Yun-Wen Hu, Zhi-Tong Zhou, Shanghai Public Health Center, Shanghai 201508, China
Author contributions: All authors contributed equally to the work.
Supported by the Grants From Shanghai Commission of Science and Technology, Shanghai Bureau of Health, No. 024Y32 and the grants from the Sino-German Center for Research Promotion, No. GZ Nr. 239 (202/12)
Correspondence to: Zheng-Hong Yuan, Key Laboratory of Medical Molecular Virology, Ministry of Education and Public Health, Shanghai Medical College of Fudan University, Shanghai 200032, China. zhyuan@shmu.edu.cn
Telephone: +86-21-64161928 Fax: +86-21-64227201
Received: October 24, 2004
Revised: December 17, 2004
Accepted: December 21, 2004
Published online: August 28, 2005

Abstract

AIM: To investigate the role of inflammatory and anti-viral genes in the pathogenesis of SARS.

METHODS: cDNA microarrays were used to screen the gene expression profiles of peripheral blood mononuclear cells (PBMCs) in two SARS patients (one in the acute severe phase and the other in the convalescent phase) and a healthy donor. In addition, real-time qualitative PCR was also performed to verify the reproducibility of the microarray results. The data were further analyzed.

RESULTS: Many inflammatory and anti-viral genes were differentially expressed in SARS patients. Compared to the healthy control or the convalescent case, plenty of pro-inflammatory cytokines such as IL-1, TNF-α, IL-8, and MAPK signaling pathway were significantly upregulated in the acute severe case. However, anti-inflammatory agents such as IL-4 receptor, IL-13 receptor, IL-1Ra, and TNF-α-induced proteins 3 and 6 also increased dramatically in the acute severe case. On the contrary, a lot of IFN-stimulated genes like PKR, GBP-1 and 2, CXCL-10 and 11, and JAK/STAT signal pathway were downregulated in the acute severe case compared to the convalescent case.

CONCLUSION: Gene expression in SARS patients mirrors a host state of inflammation and anti-viral immunity at the transcription level, and understanding of gene expression profiles may make contribution to further studies of the SARS pathogenesis.

Key Words: SARS pathogenesis; Gene expression profiles; cDNA microarray; Inflammation response; Innate anti-viral immunity



INTRODUCTION

A new contagious disease occurred in 2003[1-3], which lasted for at least 6 mo and swept over 29 countries in the world, causing numerous deaths and triggering public panic[4]. However, it took less than 2 mo to successfully identify the causative agent-a novel coronavirus[3,5]. Meanwhile, investigation of the unique pathogenic mechanism of this disease is still challenging and intriguing. Clinical data suggest that it is an abnormal pathological reaction to pulmonary viral infection characterized by acute lung injury[1,2,4,6] that determines the process of the symptoms. Acute lung injury is a multi-factorial, pathophysiological process involving cytokines and adhesion molecules, as well as inflammatory and immune cells[6-8]. Many pro- and anti-inflammatory cytokines such as IL-1, TNF-α, IL-8, IL-4, and IL-10 have been demonstrated to play a pivotal role in the pathogenesis of acute lung injury and severe systemic inflammation[6,8-11]. To determine the role of cytokines in the pathogenesis of SARS, immunological techniques such as RIA, ELISPOT, and ELISA have been employed to measure cytokine alterations in blood samples from SARS patients[12-14]. Jones et al[12] reported that the number of IFN-γ, IL-2, IL-4, IL-10, and IL-12 secreting cells induced by T-cell activators is below normal in many or most patients, while the number of cells which are induced to produce IL-6 and TNF-α by T-cell or monocyte activators is higher than normal in many early SARS patients, and increases in some SARS patients during and after treatment. Wong et al[13] found that Th1 cytokine, inflammatory cytokines such as IL-1, IL-6, and IL-12 and chemokines such as IL-8, MCP-1, and IP-10 are increased. Furthermore, Zhang et al[14] revealed that there is a difference in relationship between IL6, IL-8, TGF-β concentration, and SARS severity (positive for IL-6, but negative for IL-8 and TGF-β). Although these studies have shown the evidence of activated Th1 cell-mediated immunity and the hyper-innate inflammatory response, the role of these cytokines in the pathogenesis of the severe systemic inflammation and the mechanisms underlying the pathogenesis of SARS need to be further studied.

Development of microarray technology has provided a powerful tool for study of the complicated biological process in cells and tissues. cDNA microarray is used to analyze the virus-host cell interactions, and improvements have been achieved in the diagnosis, treatment, and prevention of infectious diseases[15]. Therefore, in this study, we used cDNA microarray to analyze the global gene expression profiles of peripheral blood mononuclear cells (PBMCs) from two SARS patients, one in the acute severe phase and the other in the convalescent phase. The results may make contribution to studies of the SARS pathogenesis.

MATERIALS AND METHODS
Patients

Shanghai Municipal Hospital for Infectious Diseases was the appointed hospital for SARS patients during the SARS outbreak in Shanghai area. A total of seven patients with SARS were accepted for treatment in this hospital from 2nd May to 20th August 2003. In this study, two SARS patients in different clinical courses were enrolled, one in the acute severe phase (1 wk after admission to hospital and died 1 d after blood samples were taken) and the other in the convalescent phase (about 1 mo after admission). After admission to the hospital, both patients received the standard treatment. Additional clinical information is summarized in Table 1.

Table 1 Clinical characteristics of two SARS patients.
P1P2
Age (yr)5740
GenderMaleFemale
Body temperature (°C)39.236.8
White cell count (×109/L)13.34.67
Neutrophil (×109/L)12.83.25
Lymphocyte (×109/L)0.4060.897
CD3+ (/µL)359791
CD4+CD3+/CD3+ (%)8658
CD8+CD3+/CD3+ (%)1336
CD4+CD8+CD3+/CD3+ (%)42
CD4+/CD8+6.381.62
Monocyte (×109/L)0.1220.442
Eosinophil (×109/L)0.0040.033
Basophil (×109/L)0.0090.041
OutcomeDeathRehabilitation
Blood samples and RNA isolation from peripheral blood mononuclear cells

Blood samples (5 mL each) were collected from two patients and a healthy donor with anticoagulant at bedside. PBMCs in lymphocyte separation medium (Sigma, USA) were isolated. Total RNA was isolated using the TRIzol reagent (Invitrogen, USA) according to the manufacturer’s instructions. After TRIzol purification, RNA was repurified by phenol-chloroform extraction and ethanol precipitation, and quantified by spectrophotometry. In addition, RNA samples were electrophoresed on 2.2 mol/L 0.7% agarose-formaldehyde gel and visualized by ethidium bromide staining to ensure that there was not overt RNA degradation.

Microarray hybridization and data analysis

Microarray hybridization was performed by Shanghai Genentech Company according to the standard Affymetrix protocol. In brief, RNA from two patients and a healthy control was converted to cDNA with SuperscriptTM II RT (Invitrogen, USA) and then to biotin-labeled cRNA with RNA transcript labeling kit (Affymetrix, USA). cRNA was cleaned up and qualified and then fragmented for hybridization. After hybridization to the human HG-U113A GeneChip containing approximately 13 000 unique genes or expression-signature tags (Affymetrix), the gene chips were automatically washed and stained with streptavidin-phycoerythrin by a fluidics system. After the chips were scanned with a GeneArray scanner (Hewlett-Packard, USA), gene transcript values were determined using algorithms in the Microarray Analysis Suite Software (5.0 version, Affymetrix). Each chip was scaled to an overall intensity of 1 500 to correct for minor differences in the overall chip hybridization intensity and to allow comparison between chips. Data were normalized to the average of the healthy control. The gene lists of two patients containing genes with P<0.05 were put out in the style of Excel files.

Real-time quantitative PCR

Real-time quantitative PCR of cDNA samples from two patients and a healthy control was carried out in triplicate with the indicated primers (Table 2), at a volume of 20 μL using FastStart DNA Master SYBR Green I Mixture Ki’ (Roche Diagnostics, USA) in a LightCycle’ system (Roche Diagnostics, USA). Initial denaturing for 10 min at 95 °C was followed by 45 cycles at 95 °C for 10 s, at 55 °C for 15 s, and at 72 °C for 20 s. Detection of the fluorescent products was set at the last step of each cycle. To determine the specificity of amplification, melting curve analysis was applied to all final PCR products, after the cycling protocol. In addition, template-free negative controls were run with each gene specific primer. PCR for RNA products of three samples was performed in order to exclude genomic DNA contamination. The standard curve was prepared with a serial of dilutions of genomic cDNA from a GAPDH-containing plasmid. Results were representative of three independent experiments.

Table 2 Primer sequence used in real-time quantitative PCR analysis.
Accession numberDescriptionForward primer (5’→3’)Reverse primer (5’→3’)
NM_000634IL-8R αGGAACTGGTGTCTTCAGGGCATCTAATGTCAGATTCGGGG
NM_003855IL-18R1GGGTATTACTCCTGCGTGCACCATTTTCTTCCCCGAACATCC
BC025925GAPDHGGTATCGTGGAAGGACTCATGACATGCCAGTGAGCTTCCCGTTCAGC
RESULTS
Validation of microarray results

To verify the reproducibility of the microarray results, 2 genes (IL-8 receptor-α and IL-18 receptor-1) were selected and tested by real-time quantitative PCR. GAPDH was used as internal control to normalize the total RNA. The ratios of the signal intensity of specific genes to GAPDH, as well as their comparison to microarray results, are listed in Table 3. As shown in Table 3, the results of RT-PCR analysis were aligned with those from the microarray analysis, suggesting the creditability of our microarray results.

Table 3 Comparison of microarray and real-time quantitative PCR analysis on selected genes (mean±SD).
Gene descriptionTechniquesP1P2
IL-8R αMicroarray73.52
Real-time qPCR11.63±0.150.37±0.09
IL-18R1Microarray42.33
Real-time qPCR48.55±0.360.38±0.27
Global characteristics of gene expression in PBMCs of SARS patients

We uploaded the genes altered over 2.0-fold (at http://www.mvlab-fudan.cn/part9.htm) to Affymetrix online data analysis system (https://http://www.affymetrix.com/analysis/netaffx/batch_query.affx), and then got an illustration of hierarchical structure according to their biological process. The number of genes changed over 2.0-fold in two SARS patients is summarized in Table 4. Results showed that many genes including those for cell communication, cellular physiological process, death, metabolism, organismal physiological process, and response to stimulus changed significantly in both SARS patients. The number of genes changed in the acute severe case, was much higher than that in the convalescent case.

Table 4 Functional categories of over 2.0-fold-regulated genes in two SARS patients.
ClassificationP1P2
Cell communication802 (518↑284↓)288 (116↑172↓)
Cell differentiation65 (33↑32↓)24 (6↑12↓)
Cellular physiological process1 056 (645↑411↓)406 (188↑218↓)
Coagulation42 (25↑17↓)17 (6↑11↓)
Development316 (202↑114↓)132 (50↑82↓)
Death166 (116↑50↓)80 (45↑35↓)
Extracellular structure3 (1↑2↓)2 (2↓)
organization and biogenesis
Homeostasis30 (13↑17↓)11 (8↑3↓)
Metabolism1 497 (867↑630↓)512 (191↑330↓)
Obsolete biological process1 (1↓)1 (1↓)
Organismal physiological process467 (278↑189↓)198 (110↑88↓)
Pathogenesis1 (1↑)2 (2↑)
Regulation of cell process57 (57↓)88 (48↑40↓)
Response to stimulus532 (317↑215↓)232 (124↑108↓)
Viral life cycle15 (7↑8↓)10 (5↑5↓)
Behavior14 (8↑6↓)6 (1↑5↓)
Total3 854 (2 273↑1 581↓)1 380 (527↑853↓)
Differentially expressed genes involved in inflammation and immune response in SARS patients

In the light of a pivotal role in the pathogenesis of SARS, the genes involved in inflammation, immune response or anti-viral effect are categorized in Tables 5, Table 6 and Table 7.

Table 5 Differentially expressed genes encoding pro- and anti-inflammatory cytokines are involved in IL-1 and TNF-α signaling cassettes in two patients.
GenBank accessDefinitionP1P2
Pro- and anti-inflammatory cytokines and receptors
AF043337IL-88–2.46
NM_000634IL-8 receptor, α73.52
NM_001557IL-8 receptor, β51.984.29
NM_000575IL-1, α3.73
NM_000576IL-1, β6.511.31
NM_000877IL-1 receptor, type I18.38
NM_004633IL-1 receptor, type II362.043.84
U64094Soluble type II IL-1 receptor630.35
NM_003856IL-1 receptor-like 111.313.25
U65590IL-1 receptor antagonist IL-1Ra14.93
AF051151Toll/IL-1 receptor-like protein 314.93
NM_000418IL-4 receptor13.93
NM_000600IL-63.03
NM_002184IL-6 signal transducer gp130–2.14
BC001903IL-10 receptor, β4
NM_004512IL-11 receptor, α–6.06–2.30
NM_001560IL-13 receptor, α13.25
U62858IL-13 receptor5.66
U81380.2IL-13 receptor soluble form4.29
NM_000585IL-15–3.032
NM_004513IL-16–2.83
NM_014339IL-17 receptor4.29
NM_003855IL-18 receptor 142.22
NM_003853IL-18 receptor accessory protein19.7
AF269133Novel interleukin receptor–3.03
NM_004862TNF-α17.15
NM_001065TNFRSF1A4
NM_003841TNFRSF10C19.7
NM_000760G-CSF 3 receptor25.99
BC002635GM-CSF 2 receptor, α, low-affinity3.03
M64445GM-CSF receptor4.922.64
NM_002607Platelet-derived growth factor α polypeptide–2.46
NM_004347Caspase 54.59
NM_000201Intercellular adhesion molecule 117.15
NM_002162Intercellular adhesion molecule 36.28
NM_003243Transforming growth factor, β receptor III–36.76–4.59
NM_003242Transforming growth factor, β receptor II–2.30
NM_000358Transforming growth factor, β-induced, 68 ku–24.25
The genes involved in the IL-1 signaling pathway
NM_007199IL-1 receptor-associated kinase M19.7
NM_002182IL-1 receptor accessory protein25.99
AF167343Soluble IL-1 receptor accessory protein55.72
M87507IL-1 β convertase3.25
U13698IL-1-β converting enzyme isoform γ3.03
U13699IL-1-β converting enzyme isoform δ2.14
U13700IL-1-β converting enzyme isoform ε2.64
The TNF signal downstream genes
NM_004619TNF receptor-associated factor 5–2.00
NM_016614TRAF and TNF receptor-associated protein3.84–2.30
NM_006290TNF-α induced protein 35.66
NM_007115TNF-α induced protein 645.254.92
AB034747Small integral membrane protein of lysosome late endosome7.46
U50062RIP protein kinase–2.00
Table 6 Differentially expressed genes involved in immune regulation in two SARS cases.
GenBank accessDefinitionP1P2
IFN and IFN-induced genes
M29383IFN-γ2.14
NM_000416IFN-γ receptor 14.59
NM_005534IFN-γ receptor 23.84
NM_000629IFN (α, β, and ω) receptor 14.29
NM_002198IFN regulatory factor 13.84
NM_002460IFN regulatory factor 4–2.30
NM_004030IFN regulatory factor 73.25
BC001356IFN-induced protein 352.83
M34455IFN-γ-inducible indoleamine 2,3-dioxygenase5.66
NM_001548IFN-induced protein with tetratricopeptide repeats 13.03
NM_001549IFN-induced protein with tetratricopeptide repeats 46.06
NM_002053Guanylate binding protein 1, IFN-inducible3.03
NM_004120.2Guanylate binding protein 2, IFN-inducible3.73
NM_022873IFN-α-inducible protein6.5
NM_003641IFN-induced transmembrane protein 1 (9-27)2.3
NM_004509IFN-induced protein 412.14
NM_005532IFN-α inducible protein 2714.93
NM_005101IFN-stimulated protein, 15 ku6.5
NM_006417IFN-induced, hepatitis C-associated microtubular aggregate protein–2.462.64
NM_002759PKR2.14
NM_002462Mx12.14
Chemokines and receptors
NM_001511GRO155.72
NM_002993Granulocyte chemotactic protein 23.73
NM_001565CXCL1014.93
AF030514CXCL1118.38
AJ224869CXCR46.52.83
M21121RANTES–13.93
NM_001295CCR13.84
NM_000648CCR2–9.19–3.25
NM_001837CCR36.5
NM_000579CCR5–3.25–4.00
NM_001838CCR7–3.73–2.64
U20350CX3CR1–42.22
Toll-like receptors
NM_003264Toll-like receptor 28
NM_003265Toll-like receptor 3–3.25–2.30
NM_003266Toll-like receptor 43.73–2.64
NM_016562Toll-like receptor 7–17.152.3
Table 7 Differentially expressed genes involving MAPK or JAK-STAT signaling pathways in two SARS cases.
GenBank accessDefinitionP1P2
U35002JNK2 β1 protein kinase–2.00–2.14
U31601JAK-3B10.56
NM_007315STAT-12.14
NM_005419STAT-23.03
NM_003151STAT-4–2.30
NM_012448STAT5B8.57
AB005043STAT induced STAT inhibitor 15.663.03
NM_003955STAT induced STAT inhibitor 34.92
NM_002745MAPK 14
NM_002748MAPK 63.73
NM_001315MAPK 149.19
NM_004759MAPK-activated protein kinase 24.29
NM_003668MAPK-activated protein kinase 5–2.46
NM_001674Activating transcription factor 32.465.27
NM_007348Activating transcription factor 63.73

As shown in Table 5, the pro- and anti-inflammatory cytokine genes were differentially expressed in two patients. Compared to healthy control, the genes encoding IL-1, IL-8, TNF-α, and ICAM-1 increased by 3.73, 8.00, 17.15 and 17.15 folds respectively in the acute severe case. Type I IL-1 receptor, TNFRSF1A, IL-8 receptor, IL-18 receptor 1 also increased by 18.38, 4.00, 73.52/51.98, and 42.22 folds respectively in the acute severe case. However, all of them did not change in the convalescent case. In addition, many anti-inflammatory agents were also remarkably upregulated in the acute severe case. Inhibitors of IL-1 and TNF-α signal pathway such as type II IL-1 receptor, soluble type II IL-1 receptor, IL-1Ra, IRAK3, soluble IL-1 receptor accessory protein, TNFRSF10C, TNF-α-induced proteins 3 and 6 were upregulated by more than 10-folds in the acute severe case, but did not change or were expressed at low level in the convalescent case.

As shown in Table 6, in 21 IFN-related molecules, most of the IFN-related molecules except for IFNGRs and IFNAR1 were not upregulated in the severe case, but they were upregulated more than two-fold in the convalescent case. For the 12 chemokine-related genes detected in this microarray, RANTES (a marker of activated T cells) and CX3CR1 were strikingly downregulated in the acute severe case. Two viral RNA-recognized TLRs (TLR-3 and -7), especially TLR-7, were significantly downregulated in the acute severe case. The above results indicated that there was dysfunction of the innate immune responses in the acute severe case.

The altered genes which could play a vital role in the process of stress, inflammation, and immune response are summarized in Table 7. In comparison to the convalescent case, the JAK/STATs were suppressed in the acute severe case. The expression of STATs 1, 2, and 4 were not upregulated, while MAPKs were upregulated in the acute severe case as compared to the healthy control. Six out of seven components of MAPK signal cascade were upregulated.

DISCUSSION

As an emerging disease, attention has been paid to the high infectivity and virulence of SARS. In the course of the disease, the important observation is lymphopenia and the depletion of T-lymphocyte subsets in most SARS cases, indicating the immunity dysfunction in this readily-transmissible disease, particularly during its early phase[7]. Another characteristic of the disease is acute lung injury accompanied with signs of the systemic inflammation, the duration and intensity of which are closely associated with the severity and prognosis of the disease[1,2,4].

A typical feature of all inflammatory disorders is the excessive recruitment of leukocytes to the inflammation site, which is a well-orchestrated process involving several protein families, including pro-inflammatory cytokines, chemotactic cytokines, and adhesion molecules[9,10]. This process is resolved by anti-inflammatory cytokines such as IL-4, IL-10, IL-13, and TGF-β[10]. The well-known pro-inflammatory cytokines include IL-1 and TNF-α, which are induced as the signals by pattern recognition receptors (like TLRs) and initiate activation of a series of signal transduction networks to release mediators, prompting inflammation and immunity[10,16,17]. In our study, pro-inflammatory cytokines (like IL-1, IL-8, IL-17, IL-18, TNF-α and etc.) were highly expressed in the acute severe case and lowly expressed in the convalescent case. Real-time quantitative PCR of empirically selected genes also showed that pro-inflammatory cytokines were highly expressed. These findings, as expected, are consistent with the clinical stage[2,6,8], though individual variation and sensitivity of examination exist. In addition, anti-inflammatory agents (IL-4, 10, and 13 receptors) and agonists of IL-1 and TNF (type II IL-1 receptor, soluble IL-1 receptor, IL-1Ra, and TNF-α decoy receptor) increased dramatically in the acute severe case, which could constitute a negative feedback to robust inflammation or manifestations of systemic inflammation[16,17]. But whether the alteration is associated with virus replication or interaction between the viral and cellular proteins is to be further elucidated.

Chemokines are also important cytokines involved in inflammation, dendritic cell maturation, neutrophil degranulation, antibody class switching and T-cell activation[18-20]. Furthermore, recent in vitro and in vivo findings support some members of chemokine system like CXCL9, CXCL10, and CXCL11 contribute to the resolution of viral infections[19,20]. Unfortunately, transcripts of IFN-induced chemokines[18,19] (RANTES, CXCL10, and CXCL11) were downregulated in the acute severe case, while inflammatory chemokines such as GRO-1, G-CSF3R, IL-8 and its receptors increased significantly. The expression profiles of chemokines as well as neutrophil predominance in white cells reflect rampant inflammation in the acute severe case[8,9].

Although the acute severe case is treated with IFN-α, poor expression of IFN-stimulated genes[21], TLR3, 7 and immune cell activation markers (CD antigens and MHC molecules, data not shown) may mirror the defect of host anti-viral immunity. Furthermore, some studies indicate that the activation of some pro-inflammatory cytokines such as IL-1, IL-6 or IL-8 signaling pathways interferes with the IFN signaling[22-25], let alone the action of IL-4, IL-10 or IL-13[9]. Outbreak of pro- and anti-inflammatory agents might interfere with the IFN signaling pathway, but direct interaction between coronavirus and IFN system cannot be excluded.

It is intriguing to find that, although the important genes involved in NF-κB signaling pathway were not detected in our microarrays, JAK/STAT signaling pathway was suppressed, another important signaling pathway associated with production of inflammatory cytokines, the MAPK signaling pathway[20,26,27] was upregulated in the acute severe case compared to the healthy control or convalescent case. It was reported that there are expression alterations in the MAPK pathway in different leukocytes from patients with SARS and virus infection and viral proteins exert effects on the MAPK signaling pathway in cell culture models[27-29]. But the relationship between changes of three signaling pathways and the SARS process needs to be further studied.

In conclusion, our results may partially reveal the different expression patterns of inflammatory and immune genes and related signal pathways at different phases of SARS pathological process. The overexpressed pro- and anti-inflammatory cytokines may contribute to acute lung injury and imbalance of homeostasis especially in acute severe phase. Thus our results may hopefully make a contribution to further studies of the SARS pathogenesis.

References
1.  Nie QH, Luo XD, Zhang JZ, Su Q. Current status of severe acute respiratory syndrome in China. World J Gastroenterol. 2003;9:1635-1645.  [PubMed]  [DOI]
2.  Peiris JS, Yuen KY, Osterhaus AD, Stöhr K. The severe acute respiratory syndrome. N Engl J Med. 2003;349:2431-2441.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1053]  [Cited by in RCA: 889]  [Article Influence: 38.7]  [Reference Citation Analysis (0)]
3.  Rota PA, Oberste MS, Monroe SS, Nix WA, Campagnoli R, Icenogle JP, Peñaranda S, Bankamp B, Maher K, Chen MH. Characterization of a novel coronavirus associated with severe acute respiratory syndrome. Science. 2003;300:1394-1399.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2027]  [Cited by in RCA: 1853]  [Article Influence: 80.6]  [Reference Citation Analysis (0)]
4.  Stadler K, Masignani V, Eickmann M, Becker S, Abrignani S, Klenk HD, Rappuoli R. SARS--beginning to understand a new virus. Nat Rev Microbiol. 2003;1:209-218.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 353]  [Cited by in RCA: 385]  [Article Influence: 17.5]  [Reference Citation Analysis (0)]
5.  Marra MA, Jones SJ, Astell CR, Holt RA, Brooks-Wilson A, Butterfield YS, Khattra J, Asano JK, Barber SA, Chan SY. The Genome sequence of the SARS-associated coronavirus. Science. 2003;300:1399-1404.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1652]  [Cited by in RCA: 1530]  [Article Influence: 66.5]  [Reference Citation Analysis (1)]
6.  Bhatia M, Moochhala S. Role of inflammatory mediators in the pathophysiology of acute respiratory distress syndrome. J Pathol. 2004;202:145-156.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 916]  [Cited by in RCA: 858]  [Article Influence: 39.0]  [Reference Citation Analysis (3)]
7.  Wong RS, Wu A, To KF, Lee N, Lam CW, Wong CK, Chan PK, Ng MH, Yu LM, Hui DS. Haematological manifestations in patients with severe acute respiratory syndrome: retrospective analysis. BMJ. 2003;326:1358-1362.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 461]  [Cited by in RCA: 419]  [Article Influence: 18.2]  [Reference Citation Analysis (0)]
8.  Hotchkiss RS, Karl IE. The pathophysiology and treatment of sepsis. N Engl J Med. 2003;348:138-150.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3085]  [Cited by in RCA: 2763]  [Article Influence: 120.1]  [Reference Citation Analysis (8)]
9.  Nathan C. Points of control in inflammation. Nature. 2002;420:846-852.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1820]  [Cited by in RCA: 1848]  [Article Influence: 77.0]  [Reference Citation Analysis (4)]
10.  Hanada T, Yoshimura A. Regulation of cytokine signaling and inflammation. Cytokine Growth Factor Rev. 2002;13:413-421.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 583]  [Cited by in RCA: 537]  [Article Influence: 22.4]  [Reference Citation Analysis (0)]
11.  Xu L, Yoon H, Zhao MQ, Liu J, Ramana CV, Enelow RI. Cutting edge: pulmonary immunopathology mediated by antigen-specific expression of TNF-alpha by antiviral CD8+ T cells. J Immunol. 2004;173:721-725.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 94]  [Cited by in RCA: 94]  [Article Influence: 4.3]  [Reference Citation Analysis (0)]
12.  Jones BM, Ma ES, Peiris JS, Wong PC, Ho JC, Lam B, Lai KN, Tsang KW. Prolonged disturbances of in vitro cytokine production in patients with severe acute respiratory syndrome (SARS) treated with ribavirin and steroids. Clin Exp Immunol. 2004;135:467-473.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 52]  [Cited by in RCA: 51]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
13.  Wong CK, Lam CW, Wu AK, Ip WK, Lee NL, Chan IH, Lit LC, Hui DS, Chan MH, Chung SS. Plasma inflammatory cytokines and chemokines in severe acute respiratory syndrome. Clin Exp Immunol. 2004;136:95-103.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1029]  [Cited by in RCA: 945]  [Article Influence: 43.0]  [Reference Citation Analysis (0)]
14.  Zhang Y, Li J, Zhan Y, Wu L, Yu X, Zhang W, Ye L, Xu S, Sun R, Wang Y. Analysis of serum cytokines in patients with severe acute respiratory syndrome. Infect Immun. 2004;72:4410-4415.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 257]  [Cited by in RCA: 267]  [Article Influence: 12.1]  [Reference Citation Analysis (0)]
15.  Bryant PA, Venter D, Robins-Browne R, Curtis N. Chips with everything: DNA microarrays in infectious diseases. Lancet Infect Dis. 2004;4:100-111.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 161]  [Cited by in RCA: 140]  [Article Influence: 6.4]  [Reference Citation Analysis (0)]
16.  Auron PE. The interleukin 1 receptor: ligand interactions and signal transduction. Cytokine Growth Factor Rev. 1998;9:221-237.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 125]  [Cited by in RCA: 123]  [Article Influence: 4.4]  [Reference Citation Analysis (0)]
17.  Chung JY, Park YC, Ye H, Wu H. All TRAFs are not created equal: common and distinct molecular mechanisms of TRAF-mediated signal transduction. J Cell Sci. 2002;115:679-688.  [PubMed]  [DOI]
18.  Luster AD. The role of chemokines in linking innate and adaptive immunity. Curr Opin Immunol. 2002;14:129-135.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 354]  [Cited by in RCA: 324]  [Article Influence: 13.5]  [Reference Citation Analysis (0)]
19.  Mahalingam S, Friedland JS, Heise MT, Rulli NE, Meanger J, Lidbury BA. Chemokines and viruses: friends or foes? Trends Microbiol. 2003;11:383-391.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 16]  [Cited by in RCA: 17]  [Article Influence: 0.7]  [Reference Citation Analysis (0)]
20.  Sen GC. Viruses and interferons. Annu Rev Microbiol. 2001;55:255-281.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 766]  [Cited by in RCA: 709]  [Article Influence: 28.4]  [Reference Citation Analysis (2)]
21.  de Veer MJ, Holko M, Frevel M, Walker E, Der S, Paranjape JM, Silverman RH, Williams BR. Functional classification of interferon-stimulated genes identified using microarrays. J Leukoc Biol. 2001;69:912-920.  [PubMed]  [DOI]
22.  Khabar KS, Al-Zoghaibi F, Al-Ahdal MN, Murayama T, Dhalla M, Mukaida N, Taha M, Al-Sedairy ST, Siddiqui Y, Kessie G. The alpha chemokine, interleukin 8, inhibits the antiviral action of interferon alpha. J Exp Med. 1997;186:1077-1085.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 107]  [Cited by in RCA: 105]  [Article Influence: 3.6]  [Reference Citation Analysis (0)]
23.  Nagabhushanam V, Solache A, Ting LM, Escaron CJ, Zhang JY, Ernst JD. Innate inhibition of adaptive immunity: Mycobacterium tuberculosis-induced IL-6 inhibits macrophage responses to IFN-gamma. J Immunol. 2003;171:4750-4757.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 176]  [Cited by in RCA: 193]  [Article Influence: 8.8]  [Reference Citation Analysis (0)]
24.  Polyak SJ, Khabar KS, Paschal DM, Ezelle HJ, Duverlie G, Barber GN, Levy DE, Mukaida N, Gretch DR. Hepatitis C virus nonstructural 5A protein induces interleukin-8, leading to partial inhibition of the interferon-induced antiviral response. J Virol. 2001;75:6095-6106.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 237]  [Cited by in RCA: 235]  [Article Influence: 9.4]  [Reference Citation Analysis (1)]
25.  Tian Z, Shen X, Feng H, Gao B. IL-1 beta attenuates IFN-alpha beta-induced antiviral activity and STAT1 activation in the liver: involvement of proteasome-dependent pathway. J Immunol. 2000;165:3959-3965.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 57]  [Cited by in RCA: 50]  [Article Influence: 1.9]  [Reference Citation Analysis (0)]
26.  Dong C, Davis RJ, Flavell RA. MAP kinases in the immune response. Annu Rev Immunol. 2002;20:55-72.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1313]  [Cited by in RCA: 1333]  [Article Influence: 53.3]  [Reference Citation Analysis (0)]
27.  Lee CH, Chen RF, Liu JW, Yeh WT, Chang JC, Liu PM, Eng HL, Lin MC, Yang KD. Altered p38 mitogen-activated protein kinase expression in different leukocytes with increment of immunosuppressive mediators in patients with severe acute respiratory syndrome. J Immunol. 2004;172:7841-7847.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 53]  [Cited by in RCA: 55]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
28.  Mizutani T, Fukushi S, Saijo M, Kurane I, Morikawa S. Importance of Akt signaling pathway for apoptosis in SARS-CoV-infected Vero E6 cells. Virology. 2004;327:169-174.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 58]  [Cited by in RCA: 57]  [Article Influence: 2.6]  [Reference Citation Analysis (0)]
29.  Mizutani T, Fukushi S, Saijo M, Kurane I, Morikawa S. Phosphorylation of p38 MAPK and its downstream targets in SARS coronavirus-infected cells. Biochem Biophys Res Commun. 2004;319:1228-1234.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 115]  [Cited by in RCA: 126]  [Article Influence: 5.7]  [Reference Citation Analysis (0)]
Footnotes

Co-first-authors: Shi-Yan Yu and Yun-Wen Hu

Science Editor Wang XL and Guo SY Language Editor Elsevier HK

Write to the Help Desk