BPG is committed to discovery and dissemination of knowledge
Basic Research Open Access
©The Author(s) 2004. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Apr 1, 2004; 10(7): 1010-1014
Published online Apr 1, 2004. doi: 10.3748/wjg.v10.i7.1010
Cryopreservation and gel collagen culture of porcine hepatocytes
Hong-Ling Liu, Ying-Jie Wang, Hai-Tao Guo, Yu-Ming Wang, Jun Liu, Yue-Cheng Yu, Research Institute of Infectious Diseases, Southwest Hospital, Third Military Medical University, Chongqing 400038, China
Hong-Ling Liu, Now in 302 Hospital of the PLA, Beijing 100039, China
Author contributions: All authors contributed equally to the work.
Supported by the Natural Scientific Foundation of Nation, No. 30027001, and the National Excellent Doctor Special Foundation, No.199947
Correspondence to: Dr. Ying-Jie Wang, Research Institute of Infectious Diseases, Southwest Hospital, Third Military Medical University, Chongqing 400038, China. wangyj103@263.net Telephone: +86-23-68754289
Received: October 27, 2003
Revised: November 6, 2003
Accepted: November 13, 2003
Published online: April 1, 2004

Abstract

AIM: To study the method of cryopreserving porcine hepatocytes and gel collagen culture measure after its cryopreservation.

METHODS: Hepatocytes, isolated from Chinese experimental suckling mini-pigs by two-step perfusion with collagenase using an extra corporeal perfusion apparatus, were cryopreserved with 50 mL/L to 200 mL/L DMSO in liquid nitrogen for 4 mo, then thawed and seeded in 1 or between 2 layers of gel collagen. The expression of porcine albumin message RNA, cellular morphology and content of aspartate aminotransferase (AST) and urea nitrogen (UN) were examined during culture in gel.

RESULTS: Viability of 150 mL/L DMSO group thawed hepatocytes was (83 ± 4)%, but after purification, its viability was (90 ± 5)%, attachment efficiency was (86 ± 7)%, the viability of thawed hepatocytes was near to fresh cells. When the thawed hepatocytes were cultivated in gel collagen with culture medium adding epidermal growth factor, the hepatocytes grew in various administrative levels in mixed collagen gel, and bunchy in the sandwich configuration cultures. For up to 10 days’ culture, the typical cellular morphological characteristics of cultivated hepatocytes could be observed. The leakage of AST was lower during culture in gel than that in common culture. At the same time, the UN synthesized by cells cultivated in mixed gel collagen was higher than that in other groups.

CONCLUSION: Storage in liquid nitrogen can long keep hepatocytes’ activities, the concentration of 150 mL/L DMSO is fit for porcine hepatocytes’ cryopreservation. Thawed hepatocytes can be cultivated with collagenous matrix, which provides an environment that more closely resembles that in vivo and maintain the expression of certain liver-specific function of hepatocytes.




INTRODUCTION

Bioartificial liver support systems (BALSS), which employ freshly isolated primary hepatocytes, present severe logistic difficulties in the continuous supply of hepatocytes[1-3]. Stored frozen hepatocytes that are thawed as required would solve this problem. Now, storing hepatocytes in liquid nitrogen was an important method to keep its biological abilities, suitable preserving measure can offer high vigorous hepatocytes for several researches. With the further development of related subjects, long-term preservation methods and active architecture of hepatocytes were needed badly to meet the immediate requirement of bioartificial liver and correlated researches[4-7]. Cryopreservation of hepatocytes is essential for the emergent treatment of acute liver failure. Morsiani et al[8-13] reported the clinical use of such thawed cells. These clinical reports certainly reflect the progress made to date in the isolation and handling of hepatocytes, and it is hoped this will lead to a wider use of cellular therapies in liver diseases.

In order to find a suitable cryopreservation and culture measure, hepatocytes from newly born Chinese experimental mini-pigs were cryopreserved in -196 °C for 4 mo, then thawed hepatocytes were cultivated with mixed gel or sandwich gel collagen, and their morphology and biological functions were compared. So this study was to develop a cryopreservation protocol for long-time preparation of porcine hepatocytes, and to determine an optimal purification procedure and culture methods for thawed hepatocytes. At last it could provide important experimental data for the research of bioartificial liver and hepatocytes transplantation.

MATERIALS AND METHODS
Isolation of porcine hepatocytes

Pig hepatocytes were harvested from newly born Chinese experimental mini-pigs (Experimental Animal Center, Third Military Medical University) using the two-step collagenase perfusion method that was modified from the original methods developed by Seglen et al[4,20-22]. Briefly, the animals were anesthetized with barbital (30 mg/kg, b.w, intraperitoneally) and their livers were removed. The liver was first perfused in vitro via the portal vein with warmed (37 °C) Ca2+ and Mg2+ free Hanks balanced salt solution at a flow rate of 20-30 mL/min for 10-15 mL/min, and then perfused with 0.5 g/L collagenase (Sigma, Type IV) in the same solution supplemented with 5 mM CaCl2 and 50 mM HEPES. The reperfusion with collagenase solution lasted 20 min at a rate of 20 mL/min at 37 °C. After 10 min of incubation (37 °C) with gentle shaking, the cells suspension was filtered and centrifuged at 50 g, 3 min for 3 times. The viability of the isolated liver cells was determined using standard trypan blue exclusion, ranged from 89% to 98%[14-18].

Cryopreservation of porcine hepatocytes

Isolated hepatocytes were slowly resuspended and gently mixed at 5 × 109cells/L concentration in different cyropreserving solution which consists of 200 mL/L fetal bovine serum (FBS) and 50 mL/L, 100 mL/L, 150 mL/L or 200 mL/L dimethyl sulphoxide (DMSO, Sigma, America), then placed hepatocytes in 1 mL freezing tube (AXYGEN, America), tagged and put into isopropanol. The concrete freezing procedure was: put in room temperature for 15 min; 4 °C for 20 min; -20 °C for 30 min; and stayed overnight at -80 °C, at last, liquid nitrogen for long-term preservation[7,19-23].

Thawing and removal of DMSO

Four months later, the vials were removed from liquid nitrogen and rapidly thawed by immersion in a 37 °C water bath. Immediately after thawing, dimethyl sulfoxide was removed by successive dilutions in 50 mL tubes, 20 mL of Leibowitz-15 medium containing 100 mL/L FBS was gently added to 1.0 mL of cell suspension at 3 min of intervals. The cells were washed three times by centrifugation for 3 minutes at 30 g and 4 °C to remove cryoprotectant. Then hepatocytes pellet was resuspended in L-15 medium with 100 mL/L FBS. Cell viability was estimated by trypan blue dye exclusion. 1 × 106 thawed hepatocytes were centrifuged at 1000 rpm for 10 min, the supernatants of medium discarded, pellet cells fixed by 30 mL/L glutaral and 10 mL/L OsO4etc, and hepatocytes’ ultrastructure was observed through transmission electron microscope[24,25].

Percoll purification of thawed hepatocytes

Working Percoll solution I was prepared by adding 1 part of 10 concentrated D-phosphate-buffered saline into 9 parts of Percoll. Then working Percoll solution II was consisted of 30 mL working Percoll solution I and phosphate-buffered saline. Hepatocytes purification was made by a procedure: to 10 mL of cell suspension, 25 mL of working Percoll solution II were added. The cells pellet was collected by centrifugation at 500 g during 3 min, resuspended, and purified hepatocytes were washed 3 times by centrifugation for 3 min at 30 g and 4 °C.

Common, mixed collagen gel and sandwich configuration culture of thawed hepatocytes

Then hepatocytes were inoculated at 106 cell/ bottle in L-15 medium added by 100 mL/L FBS, 10 μl/L glucagons, 200 U/L insulin and 20 ng/L epidermal growth factor (Sigma), as a control group and the medium was changed every day. The morphologies of hepatocytes were observed under inverted microscope, supernatants of culture cells was stored at -20 °C for examination. Viability of cells was determined using standard trypan blue exclusion measure.

The collagen solution was prepared just before its use by mixing three parts of collagen type VII (Sigma) in one part of 4 × Dulbecco’s modified Eagle’s medium (Gibco, America) without bicarbonate (pH 7.4), adjusting its pH to 7.20 with 1N NaOH. One million cells were mixed with 2 mL collagen solution and incubated in T-flasks (25cm2) at 37 °C. When the mixed collagen matrix was fixed in an hour, the gel was washed slowly and medium was added, and hepatocytes were incubated at 37 °C with 100 mL/L CO2 900 mL/L humidity. The methods of culture and observation were the same to the control group[26,27].

When thawed hepatocytes were cultivated in sandwich configuration, the collagen solution was prepared just as before, then T-flasks were coated with it and incubated one hour at 37 °C. One million cells were cultivated with L-15 medium. Nonattached hepatocytes were washed after one hour; second layer of collagen solution was spread to sandwich the hepatocytes after 24 h. Thirty minutes later, sandwich configuration hepatocytes were formed[28-30], and the methods of culture and observation were just performed as before.

Expression of porcine hepatocytes albumin message RNA

When hepatocytes were cultivated for one week, its total RNA were distillated by Tripure isolated reagent (the gel cultured hepatocytes were digested with 0.5 g/L pancreatin before distillated). The sequences of primers are designed in Table 1. “House-keeping gene” glyceraldehydes-3-phosphate dehydrogenase (G3PDH) gene was kept as inner standard[31].

Table 1 Nucleotide sequences of primers and band sizes.
PrimersSequences (5’-3’)Band sizes
mRNAsenseCTTATTCCAGGGGTCTGTTTC324 bp
antisenseTCGTTTCTCTCAGGCTCTTCT
G3PDHsenseCATCATCCCTGCTTCTACCC160 bp
antisenseCCTGCTTCACCACTTTCTTG

RNA was reverse transcribed using a one-step RT-PCR kit (Promga, America). For RT-PCR amplification, the standard RT-PCR program of one cycle of 48 °C for 45 min and 94 °C for 4 min, 35 cycles of 95 °C for 1 min, 55 °C for 1 min, and 72 °C for 1 min and one cycle of 72 °C for 7 min were applied. The products of RT-PCR were electrophoresised on 15 g/L agarose gel, and figures were gained on Gel-DocTM2000 (BIO-RAD, America). The densities of these straps were scanned, and the odds of every group’s band/ corresponding G3PDH strap were seen as the expression of objective gene.

Aspartate aminotransferase (AST) and urea nitrogen (UN)

The level of AST and UN, in culture supernatants of the control group, mixed gel and sandwich configuration, were detected with biological analysis meter (HITACH. Japan)[32].

Data statistics

The data was analysed by the duplication measurement analysis of variance or one-way analysis of variance on SPSS 11.0 software. Results were expressed on mean±standard deviation (mean ± SD).

RESULTS
Survival rate and attaching efficiency of hepatocytes

Fresh isolated and cryopreserved/purified hepatocytes were assessed for viability and function by trypan blue dye exclusion. The yield of cells was 1.5 to 5 × 109 cells/liver. Cell viability was (91 ± 4)%, and attachment efficiency of viable hepatocytes after 24 h culture was (89 ± 5)%. After cryopreservtion, the viabilities of 50 mL/L, 100 mL/L, 150 mL/L and 200 mL/L DMSO group of hepatocytes were in Table 2. However, when the 150 mL/L DMSO group thawed hepatocytes were purified by Percoll, its viability was (90 ± 5)%, attachment efficiency was (86 ± 7)%. The viability of thawed hepatocytes were near to fresh cells.

Table 2 Viability and 24 hours attaching efficiency of thawed hepatocytes (%).
Viability/group (mL/L)50 DMSO100 DMSO150 DMSO200 DMSO
Viability51 ± 371 ± 4a83 ± 4c79 ± 5c
Attaching efficiency32 ± 670 ± 5a81 ± 5c77 ± 6a

In this table, we can see the viability of 100 mL/L DMSO group cells were much better than that of 50 mL/L and 100 mL/L DMSO groups (P < 0.05), but there was no significant difference between the group of 150 mL/L DMSO and 200 mL/L DMSO (P > 0.05).

Morphology of thawed hepatocytes

The ultrastructure of thawed hepatocytes in 150 mL/L DMSO group were kept well, number of mitochondria was normal, with slight swellen cristae, rough endoplasmic reticulum decreased, smooth endoplasmic reticulum and golgi apparatus increased, chromatin in cell nucleus distributed normal (Figure 1A).

Thawed hepatocytes of 150 mL/L DMSO group attached to dishes within 4 h (Figure 1B). After 24 hours’ culture, cells appeared polygonal, containing granular cytoplasm with one or two centrally located nuclei. Seven days later, they were more flattened and appeared bigger than 24 h cultured hepatocytes. Morphology and ultrastructure of other groups’ hepatocytes were abnormal, thus the hepatocytes of 150 mL/L group were provided for gel collagen culture.

Figure 1
Figure 1 A: The thawed hepatocytes’ ultrastructure after 4 mo cryopreservation, (TEM, × 4000), B: The morphology of thawed hepatocytes after 4 h culture (PCM, × 200).
Morphology of mixed gelled cultivated pig hepatocytes

The hepatocytes kept their biological characters well after 150 mL/L DMSO cryopreservation. When the thawed hepatocytes were mixed in gel collagen and cultivated with medium adding epidermal growth factor, the hepatocytes grow in various administrative levels in collagen gel. For up to 7 days’ culture, the typical cellular morphological characteristics of hepatocytes could be observed (Figure 2A).

Figure 2
Figure 2 A: Morphology of thawed hepatocytes cultivated in mixed gel for 4 h (PCM, × 200), B: Morphology of hepato-cytes cultivated in sandwich configuration for 24 h (PCM, × 200).
Morphology of sandwich culture pig hepatocytes

Hepatocytes, cultivated for four hours in first layer gel, turned from pellet to polygon. When second layer gel collagen was added, hepatocytes cultured in collagen sandwich configuration had a cuboid, compact, bunchy, and well-defined shape with a classical cobblestone appearance. In the seven-days’ culture period, the hepatocytes maintained their typical morphological characteristics under phase contract microscope (Figure 2B).

Expression of albumin mRNA on thawed porcine hepatocytes

When the control group mixed gel collagen and sandwich configuration porcine hepatocytes were cultivated for seven days, they all kept expression of albumin message RNA using RT-PCR, but the level of mixed gel collagen group was higher than that of other group (P < 0.05), (Figure 3 and Table 3).

Table 3 Change of albumin mRNA expression in culture pig hepatocytes (mean ± SD).
Band density/groupMixed gel group
Sandwich group
Control group
Mean rate of density0.44 ± 0.041a0.353 ± 0.021c0.261 ± 0.02
Figure 3
Figure 3 Expression of porcine albumin mRNA on culture hepatocytes after RT-PCR. M: DNA markers; lanes 1, 2 and 3 are control groups, mixed gel collagen and sandwich configuration.
Release of AST

The level of AST in common culture hepatocytes supernatant was very lower on day 1 to day 3, and ascended to the peak on day 7, which was marked higher than the group of mixed gel collagen or sandwich collagen (P < 0.05). The contents of AST in the group of gel collagen on culture 24 to 48 h were high, but they dropped at day 3 and kept at a lower level (P > 0.05), (Figure 4).

Figure 4
Figure 4 Content of AST on hepatocytes culture medium.
UN in culture supernatant

The levels of urea nitrogen synthesized by hepatocytes in three groups were different and changed. The content in common culture group decreased on day 5, and was lower than that of other groups on culture period (P < 0.05). Mixed gel group’s level was higher than that of the sandwich, but they had no marked difference. (P > 0.05), (Figure 5).

Figure 5
Figure 5 Content of urea nitrogen on hepatocytes culture medium.
DISCUSSION

Hepatocytes cryopreserved in liquid nitrogen were thought as only efficient measure to keep its ability currently[33-36]. Shortage of hepatocytes necessitates the development of improved cryopreservation techniques for long-term storage of hepatocytes to make best use of available hepatocytes. The ultimate goal of any improved cryopreservation protocol is to minimize sudden intracellular formation of ice crystals that could result in ultrastructural damage, and thus maintains cell viability, attachment, and metabolic activity on thawing. Storage time of cryopreserved hepatocytes at temperatures -196 °C may play an important role in the quality of thawed cells. Most of the available protocols use dimethyl sulfoxide in the cryopreservation medium[19,37-39].

Successful cryopreservation of porcine hepatocytes would ensure the accessibility of cells for laboratory use, permit the standardisation of experiments, save lives of animals and lead to continuous supply of hepatocytes in BALSS treatment[28,31]. Therefore, we sought the optimal procedure for cryopreservation of porcine hepatocytes for both laboratory and clinical purposes in this study. The protocol for cryopreservation of hepatocytes included the concentration of 150 mL/L DMSO, 200 mL/L fetal bovine serum and rapid thawing followed by slow dilution of DMSO to avoid osmotic shock. After 4 mo cryopreservation, the thawed cells were shown to have a reasonable level of cell viability, compared to freshly isolated hepatocytes. So the storage condition was proved to be suitable for long-time cryopreservation of pig hepatocytes. Our purification method using D-PBS and Percoll achieved a high cell recovery rate with satisfactory viability and function at high cell concentrations (5 × 109cell /L), facilitating purification of hepatocytes in large quantities. We conclude that frozen/thawed/purified cells can possess satisfactory viability and function. Large-scale cryopreservation of porcine hepatocytes may provide an efficient alternative to freshly isolated porcine hepatocytes[19,40-42].

Proper cryopreservation measure can maintain porcine hepatocytes’ abilities for a long time. However, if the thawed hepatocytes were cultivated in unfit conditions, it would not meet the need of application in clinic and basic research. Therefore, the culture pattern of thawed hepatocytes also appeared very important. Traditional cell culture measure, which was common monolayer attaching incubation, was hard to simulate the circulation that hepatocytes grew in vivo, and were not suitable for BLASS[43]. Collagen was a kind of matrix in common use to fix hepatocytes. Liver cells in vivo assume three-dimension configuration in a liver lobule, and there are complicated contacts among hepatocytes, liver non-parenchyma cells and cell matrix. Matrix is an important part of affecting hepatocytes function. Many researches showed that collagenous matrix could provides an environment that more closely resembles that in vivo and allows to maintain the expression of certain liver-specific function of hepatocytes[44-47]. In this study, the hepatocytes keep their biological characters well after storage in liquid nitrogen for 4 mo. When the thawed hepatocytes were cultivated in gelled collagen with culture medium added by epidermal growth factor, the cells grow in various administrative levels in mixed collagen gel, and bunchy in the collagen sandwich cultures. For up to 10 days’ cultures, the typical cellular polygonal morphological characteristics of culture hepatocytes could be observed, and the bound between hepatocytes appear brightly and clearly; the leakage of aspartate aminotransferase was less and the level of urea nitrogen synthesized by hepatocytes was higher. Through sandwich culture can hold hepatocytes synthesizing and metabolizing abilities, the cultivated hepatocytes was also at monolayer attaching state, and do not have normal three-dimension construction in vivo, so it needs to be further ameliorated[26,29,43].

In conclusion, through the study of many important factors in hypothermic preservation, we can optimize the hypothermic preservation protocols or cultivated conditions, and established a hepatocytes storage room. That will be helpful for the development of BAL and hepatocytes transplantation[9,40,48].

References
1.  Wang YJ, Li MD, Wang YM, Nie QH, Chen GZ. Experimental study of bioartificial liver with cultured human liver cells. World J Gastroenterol. 1999;5:135-137.  [PubMed]  [DOI]
2.  Eguchi S, Kamohara Y, Sugiyama N, Kawazoe Y, Kawashita Y, Tamura H, Morishita M, Miyamoto S, Azuma T, Fujioka H. Efficacy and current problems with a porcine hepatocyte-based bioartificial liver: light and shade. Transplant Proc. 1999;31:2014-2015.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 5]  [Article Influence: 0.2]  [Reference Citation Analysis (0)]
3.  Wu L, Sun J, Qin G, Wang C, Woodman K, Koutalistras N, Horvat M, Sheil AG. Cryopreserved porcine hepatocytes in a liver biodialysis system. Transplant Proc. 2001;33:1950-1951.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3]  [Cited by in RCA: 4]  [Article Influence: 0.2]  [Reference Citation Analysis (0)]
4.  Sarkis R, Honiger J, Chafai N, Baudrimont M, Sarkis K, Delelo R, Becquemont L, Benoist S, Balladur P, Capeau J. Semiautomatic macroencapsulation of fresh or cryopreserved porcine hepatocytes maintain their ability for treatment of acute liver failure. Cell Transplant. 2001;10:601-607.  [PubMed]  [DOI]
5.  Sarkis R, Benoist S, Honiger J, Baudrimont M, Delelo R, Balladur P, Capeau J, Nordlinger B. Transplanted cryopreserved encapsulated porcine hepatocytes are as effective as fresh hepatocytes in preventing death from acute liver failure in rats. Transplantation. 2000;70:58-64.  [PubMed]  [DOI]
6.  Khalili TM, Navarro A, Ting P, Kamohara Y, Arkadopoulos N, Solomon BA, Demetriou AA, Rozga J. Bioartificial liver treatment prolongs survival and lowers intracranial pressure in pigs with fulminant hepatic failure. Artif Organs. 2001;25:566-570.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 26]  [Cited by in RCA: 23]  [Article Influence: 0.9]  [Reference Citation Analysis (0)]
7.  Sarkis R, Honiger J, Chafai N, Baudrimont M, Sarkis K, Delelo R, Becquemont L, Benoist S, Balladur P, Capeau J. Semiautomatic macroencapsulation of fresh or cryopreserved porcine hepatocytes maintain their ability for treatment of acute liver failure. Cell Transplant. 2001;10:601-607.  [PubMed]  [DOI]
8.  David P, Alexandre E, Audet M, Chenard-Neu MP, Wolf P, Jaeck D, Azimzadeh A, Richert L. Engraftment and albumin production of intrasplenically transplanted rat hepatocytes (Sprague-Dawley), freshly isolated versus cryopreserved, into Nagase analbuminemic rats (NAR). Cell Transplant. 2001;10:67-80.  [PubMed]  [DOI]
9.  Morsiani E, Brogli M, Galavotti D, Bellini T, Ricci D, Pazzi P, Puviani AC. Long-term expression of highly differentiated functions by isolated porcine hepatocytes perfused in a radial-flow bioreactor. Artif Organs. 2001;25:740-748.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 49]  [Cited by in RCA: 38]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
10.  Morsiani E, Pazzi P, Puviani AC, Brogli M, Valieri L, Gorini P, Scoletta P, Marangoni E, Ragazzi R, Azzena G. Early experiences with a porcine hepatocyte-based bioartificial liver in acute hepatic failure patients. Int J Artif Organs. 2002;25:192-202.  [PubMed]  [DOI]
11.  Eguchi S, Kawazoe Y, Sugiyama N, Kawashita Y, Fujioka H, Furui J, Sato M, Ishii T, Kanematsu T. Effects of recombinant human hepatocyte growth factor on the proliferation and function of porcine hepatocytes. ASAIO J. 2000;46:56-59.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 10]  [Article Influence: 0.4]  [Reference Citation Analysis (0)]
12.  Gao Y, Xu XP, Hu HZ, Yang JZ. Cultivation of human liver cell lines with microcarriers acting as biological materials of bioartificial liver. World J Gastroenterol. 1999;5:221-224.  [PubMed]  [DOI]
13.  Alexandre E, Viollon-Abadie C, David P, Gandillet A, Coassolo P, Heyd B, Mantion G, Wolf P, Bachellier P, Jaeck D. Cryopreservation of adult human hepatocytes obtained from resected liver biopsies. Cryobiology. 2002;44:103-113.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 76]  [Cited by in RCA: 78]  [Article Influence: 3.3]  [Reference Citation Analysis (0)]
14.  Gao Y, Hu HZ, Chen K, Yang JZ. Primary porcine hepatocytes with portal vein serum cultured on microcarriers or in spheroidal aggregates. World J Gastroenterol. 2000;6:365-370.  [PubMed]  [DOI]
15.  Matsushita T, Yagi T, Hardin JA, Cragun JD, Crow FW, Bergen HR, Gores GJ, Nyberg SL. Apoptotic cell death and function of cryopreserved porcine hepatocytes in a bioartificial liver. Cell Transplant. 2003;12:109-121.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 42]  [Cited by in RCA: 40]  [Article Influence: 1.8]  [Reference Citation Analysis (0)]
16.  Funatsu K, Ijima H, Nakazawa K, Yamashita Y, Shimada M, Sugimachi K. Hybrid artificial liver using hepatocyte organoid culture. Artif Organs. 2001;25:194-200.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 80]  [Cited by in RCA: 68]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
17.  Mitry RR, Hughes RD, Dhawan A. Progress in human hepatocytes: isolation, culture & amp; cryopreservation. Semin Cell Dev Biol. 2002;13:463-467.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 71]  [Cited by in RCA: 67]  [Article Influence: 2.8]  [Reference Citation Analysis (0)]
18.  Yao YQ, Zhang DF, Huang AL, Luo Y, Zhang DZ, Wang B, Zhou WP, Ren H, Guo SH. Effects of electroporation on primary rat hepatocytes in vitro. World J Gastroenterol. 2002;8:893-896.  [PubMed]  [DOI]
19.  Guillouzo A, Rialland L, Fautrel A, Guyomard C. Survival and function of isolated hepatocytes after cryopreservation. Chem Biol Interact. 1999;121:7-16.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 55]  [Cited by in RCA: 52]  [Article Influence: 1.9]  [Reference Citation Analysis (0)]
20.  Yagi T, Hardin JA, Valenzuela YM, Miyoshi H, Gores GJ, Nyberg SL. Caspase inhibition reduces apoptotic death of cryopreserved porcine hepatocytes. Hepatology. 2001;33:1432-1440.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 98]  [Cited by in RCA: 93]  [Article Influence: 3.7]  [Reference Citation Analysis (0)]
21.  Xue YL, Zhao SF, Luo Y, Li XJ, Duan ZP, Chen XP, Li WG, Huang XQ, Li YL, Cui X. TECA hybrid artificial liver support system in treatment of acute liver failure. World J Gastroenterol. 2001;7:826-829.  [PubMed]  [DOI]
22.  Darr TB, Hubel A. Postthaw viability of precultured hepatocytes. Cryobiology. 2001;42:11-20.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 30]  [Cited by in RCA: 28]  [Article Influence: 1.1]  [Reference Citation Analysis (0)]
23.  Hubel A, Conroy M, Darr TB. Influence of preculture on the prefreeze and postthaw characteristics of hepatocytes. Biotechnol Bioeng 2000-. 2001;71:173-183.  [PubMed]  [DOI]  [Full Text]
24.  Hengstler JG, Utesch D, Steinberg P, Platt KL, Diener B, Ringel M, Swales N, Fischer T, Biefang K, Gerl M. Cryopreserved primary hepatocytes as a constantly available in vitro model for the evaluation of human and animal drug metabolism and enzyme induction. Drug Metab Rev. 2000;32:81-118.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 203]  [Cited by in RCA: 198]  [Article Influence: 7.6]  [Reference Citation Analysis (0)]
25.  Gerlach JC, Zeilinger K, Sauer IM, Mieder T, Naumann G, Grünwald A, Pless G, Holland G, Mas A, Vienken J. Extracorporeal liver support: porcine or human cell based systems? Int J Artif Organs. 2002;25:1013-1018.  [PubMed]  [DOI]
26.  Kono Y, Yang S, Roberts EA. Extended primary culture of human hepatocytes in a collagen gel sandwich system. In Vitro Cell Dev Biol Anim. 1997;33:467-472.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 52]  [Cited by in RCA: 49]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
27.  Lorenti A, Barbich M, Hidalgo A, Hyon SH, Sorroche P, Guinle A, Schenone A, Chamoles N, Argibay P. Culture of porcine hepatocytes: the dogma of exogenous matrix revisited. Artif Organs. 2001;25:546-550.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 9]  [Article Influence: 0.4]  [Reference Citation Analysis (0)]
28.  Lau YY, Sapidou E, Cui X, White RE, Cheng KC. Development of a novel in vitro model to predict hepatic clearance using fresh, cryopreserved, and sandwich-cultured hepatocytes. Drug Metab Dispos. 2002;30:1446-1454.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 110]  [Cited by in RCA: 97]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
29.  Weiss TS, Jahn B, Cetto M, Jauch KW, Thasler WE. Collagen sandwich culture affects intracellular polyamine levels of human hepatocytes. Cell Prolif. 2002;35:257-267.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 43]  [Cited by in RCA: 41]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
30.  Hong JT, Glauert HP. Effect of extracellular matrix on the expression of peroxisome proliferation associated genes in cultured rat hepatocytes. Toxicol In Vitro. 2000;14:177-184.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 7]  [Cited by in RCA: 7]  [Article Influence: 0.3]  [Reference Citation Analysis (0)]
31.  Benoist S, Sarkis R, Chafaï N, Barbu V, Honiger J, Lakehal F, Becquemont L, Baudrimont M, Capeau J, Housset C. Survival and differentiation of porcine hepatocytes encapsulated by semiautomatic device and allotransplanted in large number without immunosuppression. J Hepatol. 2001;35:208-216.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 7]  [Article Influence: 0.3]  [Reference Citation Analysis (0)]
32.  Vilei MT, Granato A, Ferraresso C, Neri D, Carraro P, Gerunda G, Muraca M. Comparison of pig, human and rat hepatocytes as a source of liver specific metabolic functions in culture systems--implications for use in bioartificial liver devices. Int J Artif Organs. 2001;24:392-396.  [PubMed]  [DOI]
33.  Nagaki M, Miki K, Kim YI, Ishiyama H, Hirahara I, Takahashi H, Sugiyama A, Muto Y, Moriwaki H. Development and characterization of a hybrid bioartificial liver using primary hepatocytes entrapped in a basement membrane matrix. Dig Dis Sci. 2001;46:1046-1056.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 33]  [Cited by in RCA: 26]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
34.  Enosawa S, Miyashita T, Fujita Y, Suzuki S, Amemiya H, Omasa T, Hiramatsu S, Suga K, Matsumura T. In vivo estimation of bioartificial liver with recombinant HepG2 cells using pigs with ischemic liver failure. Cell Transplant. 2001;10:429-433.  [PubMed]  [DOI]
35.  Houle R, Raoul J, Lévesque JF, Pang KS, Nicoll-Griffith DA, Silva JM. Retention of transporter activities in cryopreserved, isolated rat hepatocytes. Drug Metab Dispos. 2003;31:447-451.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 31]  [Cited by in RCA: 26]  [Article Influence: 1.1]  [Reference Citation Analysis (0)]
36.  Tzanakakis ES, Hess DJ, Sielaff TD, Hu WS. Extracorporeal tissue engineered liver-assist devices. Annu Rev Biomed Eng. 2000;2:607-632.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 56]  [Cited by in RCA: 35]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
37.  Baust JM, Vogel MJ, Van Buskirk R, Baust JG. A molecular basis of cryopreservation failure and its modulation to improve cell survival. Cell Transplant. 2001;10:561-571.  [PubMed]  [DOI]
38.  Gao Y, Hu HZ, Chen K, Yang JZ. Primary porcine hepatocytes with portal vein serum cultured on microcarriers or in spheroidal aggregates. World J Gastroenterol. 2000;6:365-370.  [PubMed]  [DOI]
39.  Sechser A, Osorio J, Freise C, Osorio RW. Artificial liver support devices for fulminant liver failure. Clin Liver Dis. 2001;5:415-430.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 25]  [Cited by in RCA: 25]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
40.  Nyberg SL, Hay EJ, Ramin KD, Rosen CB. Successful pregnancy after porcine bioartificial liver treatment and liver transplantation for fulminant hepatic failure. Liver Transpl. 2002;8:169-170.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3]  [Cited by in RCA: 4]  [Article Influence: 0.2]  [Reference Citation Analysis (0)]
41.  Lorenti A, Barbich M, Hidalgo A, Hyon SH, Sorroche P, Guinle A, Schenone A, Chamoles N, Argibay P. Culture of porcine hepatocytes: the dogma of exogenous matrix revisited. Artif Organs. 2001;25:546-550.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 9]  [Article Influence: 0.4]  [Reference Citation Analysis (0)]
42.  Sugimoto S, Mitaka T, Ikeda S, Harada K, Ikai I, Yamaoka Y, Mochizuki Y. Morphological changes induced by extracellular matrix are correlated with maturation of rat small hepatocytes. J Cell Biochem. 2002;87:16-28.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 45]  [Cited by in RCA: 45]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
43.  De Smet K, Cavin C, Vercruysse A, Rogiers V. Collagen type I gel cultures of adult rat hepatocytes as a screening induction model for cytochrome P450-dependent enzymes. Altern Lab Anim. 2001;29:179-192.  [PubMed]  [DOI]
44.  Unger JK, Catapano G, Horn NA, Schroers A, Gerlach JC, Rossaint R. Comparative analysis of metabolism of medium- and plasma perfused primary pig hepatocytes cultured around a 3-D membrane network. Int J Artif Organs. 2000;23:104-110.  [PubMed]  [DOI]
45.  Tréhout D, Desille M, Doan BT, Mahler S, Frémond B, Mallédant Y, Campion JP, Desbois J, Beloeil JC, de Certaines J. Follow-up by one- and two-dimensional NMR of plasma from pigs with ischemia-induced acute liver failure treated with a bioartificial liver. NMR Biomed. 2002;15:393-403.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 10]  [Cited by in RCA: 11]  [Article Influence: 0.5]  [Reference Citation Analysis (0)]
46.  Pahernik SA, Thasler WE, Doser M, Gomez-Lechon MJ, Castell MJ, Planck H, Koebe HG. High density culturing of porcine hepatocytes immobilized on nonwoven polyurethane-based biomatrices. Cells Tissues Organs. 2001;168:170-177.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 17]  [Cited by in RCA: 17]  [Article Influence: 0.7]  [Reference Citation Analysis (0)]
47.  Haruyama T, Ajioka I, Akaike T, Watanabe Y. Regulation and significance of hepatocyte-derived matrix metalloproteinases in liver remodeling. Biochem Biophys Res Commun. 2000;272:681-686.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 57]  [Cited by in RCA: 59]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
48.  Wang YJ, Li MD, Wang YM, Chen GZ, Lu GD, Tan ZX. Effect of extracorporeal bioartificial liver support system on fulminant hepatic failure rabbits. World J Gastroenterol. 2000;6:252-254.  [PubMed]  [DOI]
Footnotes

Edited by Zhang JZ Proofread by Xu FM

Write to the Help Desk