BPG is committed to discovery and dissemination of knowledge
Brief Reports Open Access
©The Author(s) 2004. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Feb 15, 2004; 10(4): 602-605
Published online Feb 15, 2004. doi: 10.3748/wjg.v10.i4.602
Genotypes of Helicobacter pylori in patients with peptic ulcer bleeding
Chin-Lin Perng, I-Lan Hospital, Division of Gastroenterology, Department of Health, Taiwan, China
Hwai-Jeng Lin, I-Chen Sun, Division of Gastroenterology, Department of Medicine, VGH-TAIPEI, Taiwan, China
Wen-Ching Lo, Zhongxiao Municipal Hospital, Taipei, Taiwan, China
Guan-Ying Tseng, Ton-Yen General Hospital, Hsin-Chu, Taiwan, China
Yueh-Hsing Ou, Institute of Biotechnology in Medicine, School of Medical Technology and Engineering, and School of Medicine, National Yang-Ming University, Taiwan, China
Author contributions: All authors contributed equally to the work.
Correspondence to: Professor Hwai-Jeng Lin, Division of Gastroenterology, Department of Medicine, VGH-TAIPEI, Shih-Pai Rd, Sec 2, Taipei, Taiwan, 11217, China. hjlin@vghtpe.gov.tw
Telephone: +886-2-28712121 Ext 2015 Fax: +886-2-28739318
Received: October 30, 2003
Revised: November 22, 2003
Accepted: December 15, 2003
Published online: February 15, 2004

Abstract

AIM: Helicobacter pylori causes chronic gastritis, peptic ulcer, gastric cancer and MALT-lymphoma. Different genotypes of Helicobacter pylori are confirmed from diverse geographic areas. Its association with bleeding peptic ulcer remains controversial. The aim of this study was to investigate the Helicobacter pylori vacA alleles, cagA and iceA in patients with bleeding peptic ulcer.

METHODS: We enrolled patients with bleeding, non-bleeding peptic ulcers and chronic gastritis. Biopsy specimens were obtained from the antrum of the stomach for rapid urease test, bacterial culture and PCR assay. DNA extraction and polymerase chain reaction were used to detect the presence or absence of cagA and to assess the polymorphism of vacA and iceA.

RESULTS: A total of 168 patients (60.4%) (25 patients with chronic gastritis, 26 patients with bleeding gastric ulcer, 51 patients with non-bleeding gastric ulcer, 26 patients with bleeding duodenal ulcer, and 40 patients with non-bleeding duodenal ulcer) were found to have positive PCR results between January 2001 and December 2002. Concerning genotypes, we found cagA (139/278, 50%), vacA s1a (127/278, 45.7%), and ice A1 (125/278, 45%) predominated in all studied patients. In patients with bleeding peptic ulcers, vacA s1a and m1T were fewer than those in patients with non-bleeding peptic ulcers (37/106 vs 69/135, P = 0.017, and 4/106 vs 21/135, P = 0.002).

CONCLUSION: In patients with peptic ulcers, H pylori vacA s1a and m1T prevent bleeding complication.




INTRODUCTION

Helicobacter pylori (H pylori) infection has been closely linked to chronic gastritis, peptic ulcer, gastric cancer and MALT-lymphoma[1]. It is one of the most common bacterial infections of humans[2]. It remains to be answered why only a minority of H pylori carriers develop peptic ulcer disease. Host factors, H pylori strain variability, environmental factors, and NSAID play a role in the pathogenesis of peptic ulcer disease[3-5]. The clinical outcome of H pylori infection is supposed to be linked to certain strains, e.g. vacuolating cytotoxin (vacA) and the cytotoxin-associated gene (cagA)[6,7].

In patients with peptic ulcer disease, only a minority of them present with peptic ulcer hemorrhage. The incidence of peptic ulcer hemorrhage in patients with pre-existing peptic ulcer disease is less than 1% per year[8]. Whether H pylori increases the risk of ulcer bleeding is controversial. Wu et al[9] confirmed that H pylori increased the risk of peptic ulcer bleeding. Cullen et al[10] had a similar finding (OR 2.8). In addition, eradication of H pylori infection could decrease the chance of peptic ulcer bleeding[11,12]. The above evidences strongly support the link of H pylori to peptic ulcer bleeding. However, the prevalence of H pylori has been found to be lower in bleeding ulcer patients than in non-bleeders[13]. The most likely explanation is the use of NSAIDs in the absence of H pylori infection in these patients. Another reason may be false negative results in these patients[14,15]. If we excluded the usage of NSAIDs in patients with duodenal ulcer bleeding, the prevalence of H pylori infection was 97%[16].

Controversy exists concerning relationship of genotypes of H pylori with peptic ulcer bleeding. So far, there are only few reports concerning this topic[17,18]. Although H pylori infection is very common, geographic distribution of different subtypes exists[19,20]. Therefore, it is interesting to investigate the genotypes in patients with peptic ulcer bleeding. The aim of this study was to determine the genotypes of H pylori in bleeding ulcer patients in Taiwan.

MATERIALS AND METHODS

Between January 2001 and December 2002, patients with non-bleeding peptic ulcers (gastric ulcer or duodenal ulcer, at least 5 mm in diameter), bleeding peptic ulcers (spurting or oozing hemorrhage, non-bleeding visible vessel, blood clots or pigmented spots at the ulcer base) or chronic gastritis were invited to enter the study. There was no past history of upper gastrointestinal bleeding (hematemesis or melena) in patients with non-bleeding peptic ulcer in this study. Patients with pregnancy, bleeding tendency (platelet count less than 50000/mm3, prothrombin time less than 30%, or taking anti-coagulants), gastric malignancy, age under 10, or over 90 years, anti-H pylori therapy 4 weeks prior to enrollment, and inability to cooperate were excluded from the study. The study was approved by the Clinical Research Committee of the Veterans General Hospital, Taipei.

Endoscopic examination and biopsy were performed after informed consent was obtained. We took three specimens from the antrum, one for rapid urease test, another for bacterial culture and the third for DNA extraction and PCR assay. Lysates of biopsied gastric mucosa were used for PCR assay. DNA of gastric biopsy specimens was extracted according to the method described by Boom[21]. Briefly, biopsy specimens were homogenized in guanidinium isothiocyanate, using a sterile micropestle. DNA was extracted, washed and eluted in 100 μl of 10 mM Tris-HCL (pH8.3). Two μl of the eluted DNA was used for each PCR reaction.

The oligonucleotide primers for PCR amplification of specific segments are shown in Table 1[5,22-25]. For vacA evaluation, the PCR program comprised 35 cycles of denaturation at 94 °C for 1 min, annealing at 56 °C for 2 min, extension at 72 °C for 1 min, and one final extension at 72 °C for 10 min. For cagA, amplification was performed with 35 cycles of denaturation at 94 °C for 1 min, annealing at 56 °C for 2 min, extension at 72 °C for 1 min, and one final extension at 72 °C for 5 min. For iceA amplification, amplifications were performed with 40 cycles of denaturation at 95 °C for 30 s, annealing at 50 °C for 45 s, extension at 72 °C for 45 s and one final extension at 72 °C for 10 min.

Table 1 Oligonucleotide primers used for cagA, vacA and iceA genotyping.
Region detectedPrimer designationPrimer sequenceSize of PCR product (bp)References
s1 and s2VA1-F5’ATGGAAATACAACAAACACACC3’25921
VA1-R5’CTGCTTGAATGCGCCAAACTTTATC3’286
s1aSS1-F5’GTCAGCATCACACCGCAAC3’1909
s1bSS3-F5’AGCGCCATACCGCAAGAG3’1879
s1cS1C-F5’CTYGCTTTAGTRGGGYTA3’21317
m1VA3-F5’GGTCAAAATGCGGTCATGG3’2909
VA3-R5’CCATTGGTACCTGTAGAAAC3’
m1Tm1T-F5’GGTCAAAATGCGGTCATGG3’29021
m1T-R5’CTCTTAGTGCCTAAAGAAACA3’
m2VA4-F5’GGAGCCCCAGGAAACATTG3’3529
VA4-R5’CATAACTAGCGCCTTGCAC3’
iceA1iceA1F5’GTGTTTTTAACCAAAGTATC3’24716
iceA1R5’CTATAGCCASTYTCTTTGCA3’
iceA2iceA2F5’GTTGGGTATATCACAATTTAT3’22916
iceA2R5’TTRCCCTATTTTCTAGTAGGT3’
lcagAlcagAD0085’ATAATGCTAAATTAGACAACTTGAGCGA3’2975
lcagAR0085 ’TTAGAATAATCAACAAACATCACGCCAT3’

The association between H pylori genotypes and clinical diseases was determined using χ2 test and Yates’ correction or Fisher’s exact test when appropriate. A P value less than 0.05 was considered statistically significant.

RESULTS

A total of 278 patients with bleeding or non-bleeding peptic ulcers and chronic gastritis (200 males and 78 females, mean age: 62.1 years, 95% CI: 60.1-64.1 years) fulfilling the admission criteria, were included in this study. A total of 168 patients (60.4%) were found to have a positive urease test. A total of 168 patients (60.4%) (25 patients with chronic gastritis, 26 patients with bleeding gastric ulcer, 51 patients with non-bleeding gastric ulcer, 26 patients with bleeding duodenal ulcer, and 40 patients with non-bleeding duodenal ulcer) were found to have positive PCR results. The ages of patients with bleeding gastric ulcer (mean: 67.8 yr, 95% CI: 62.8-72.8), non-bleeding gastric ulcer (mean: 63.5 yrs, 95% CI: 59.8-67.2), bleeding duodenal ulcer (mean: 65.5 yrs, 95% CI: 59.2-71.8) were greater than those of patients with non-bleeding duodenal ulcer (mean: 54.6 yrs, 95% CI: 49.5-59.7, P < 0.01) and chronic gastritis (mean: 51.2 yrs, 95% CI: 42.8-59.6, P < 0.01).

In patients with bleeding gastric ulcer, there were blood clots inside the stomach in 8 patients, coffee grounds in 8 patients, and clear fluid in 10 patients. In patients with bleeding duodenal ulcers, there were blood clots inside the stomach in 8 patients, coffee grounds in two patients and clear fluid in 16 patients.

In patients with bleeding peptic ulcers, 52 (49.1%) were found to have positive PCR for H pylori. It was lower than that in those with non-bleeding peptic ulcers (91/135, 67.4%, P = 0.006) and chronic gastritis (25/37, 67.6%, P = 0.008).

The genotypes in patients with chronic gastritis, duodenal ulcers and gastric ulcers are described in Table 2. There was no statistical difference among variables in different groups.

Table 2 Genotypes of Helicobacter pylori in patients with chronic gastritis, non-bleeding duodenal ulcers (DU), bleeding DU, non-bleeding gastric ulcers (GU) and bleeding GU n%.
DiagnosisNo. of patientsNo. of positive PCRs1as1bs1cs2m1m1Tm2cagAiceA1iceA2
Chronic gastritis372521(57)0(0)14(38)0(0)0(0)8(22)12(32)22(59)22(59)2(5)
Non-bleeding DU534030(57)4(8)22(42)0(0)0(0)11(21)15(28)29(55)30(57)3(6)
Bleeding DU482617(35)4(8)15(31)2(4)2(4)3(6)12(25)25(52)19(40)7(15)
Non-bleeding GU825139(48)0(0)29(35)0(0)0(0)10(12)30(37)41(50)34(41)13(16)
Bleeding GU582620(34)1(2)13(22)0(0)0(0)1(2)15(26)22(38)20(34)4(7)

Concerning genotypes, we found cagA (139/278, 50%) , vacA s1a (127/278, 45.7%), and ice A1 (125/278, 45%) predominated in all studied patients. In patients with bleeding peptic ulcers, vacA s1a and m1T were fewer than those in patients with non-bleeding peptic ulcers (37/106 vs 69/135, P = 0.017, and 4/106 vs 21/135, P = 0.002, Table 3).

Table 3 Genotypes of Helicobacter pylori in patients with non-bleeding peptic ulcers and bleeding peptic ulcers n%.
DiagnosisNo. of patientsNo. of positive PCRs1as1bs1cs2m1m1Tm2cagAiceA1iceA2
Non-bleeding PU1359169a(51)4(3)51(38)0(0)0(0)21b(16)45(33)70(52)64(47)16(12)
Bleeding PU1065237(35)5(5)28(26)2(2)2(2)4(4)27(25)47(44)39(37)11 (10)
DISCUSSION

H pylori is a world-wide infective agent ranging from 25% in developed countries to more than 80% in the developing world[26,27]. However, not all individuals infected with H pylori develop gastric illness and this may be related to various factors such as environmental factors, host genetic factors, and bacterial virulent ability[28,29].

This study determined using PCR the cagA, vacA and iceA status of 278 patients presenting for endoscopy by examining biopsy specimens from the antrum of each patient. Of them, 168 patients (60.4%) were found to have positive PCR. In this study, predominance of vacA s1a was found in patients with bleeding and non-bleeding peptic ulcer and chronic gastritis. Our finding was similar to those reported by other authors[25,30,31]. In Hong Kong and Korea, a low incidence of vacA s1a subtype was found[32,33].

The previous Taiwan reports gave no data concerning vacA s1c[25,30]. VacA s1c was frequently found (93/278, 33.5%) in this study. In patients with bleeding peptic ulcers, vacA s1c was less than that in patients with non-bleeding peptic ulcers (26% vs 38%), but it did not reach statistical significance. The incidence of vacA s1c in this study was similar to the reports of Hong Kong[32], Korea[33], and Japan[34], but different from those in Western world[19,20]. In contrast, vacA s1b and s2 were rare. Our findings were compatible with that in mainland China[31].

Concerning the m-region of vacA, m1 strains predominated in most Western reports[19,20,27]. However, there were only 2% m1 subtypes in patients with bleeding peptic ulcers and none in patients with non-bleeding peptic ulcers in this study. We used a modified primer (m1T) [25] and some peptic ulcer patients (bleeding: 3.8%, non-bleeding: 15.6%) with H pylori infection contained this genotype. m2 strains predominated (33% in patients with non-bleeding peptic ulcers, 25% in bleeding peptic ulcers) in this study. Our finding was consistent with reports from Taiwan[25,30], Hong Kong [32], and mainland China[31]. In contrast, Japan and Korea had a much lower incidence of m2 strains[24,33]. This indicates a great variation in the vacA region in Taiwan, particularly in the mid-region locus. H pylori may have a different geographic evolution in Taiwan even compared with other East Asian countries.

IceA1 has been suggested to be related to peptic ulcer disease[23,35]. But, this finding was doubted by other authors and us[24,32,33]. In this study, we found iceA1 was the predominant subtype and showed no difference between patients with bleeding and non-bleeding peptic ulcers. IceA1 is the predominant subtype of ice in the East Asia, while iceA2 is the predominant subtype in the USA and Columbia[24].

Certain genotypes (e.g. cagA, vacA s1a) have been closely related to severe clinical outcomes and response to anti-H pylori therapy[36-38]. However, these findings are not supported by other studies[24,25,29-32,34]. The association between H pylori infection and peptic ulcer bleeding is less clear, but a strong argument for the etiological role is the fact that eradication of H pylori decreased recurrence of bleeding[39]. Stack et al[17] recently found that cag A positive H pylori was associated with an increased risk of ulcer bleeding. However, Illies et al[18] found that presence of cagA antibody was similar both in patients with bleeding and in non-bleeding controls. In this study, there was no difference of cagA between patients with non-bleeding and those with bleeding peptic ulcers. However, there were fewer vacA s1a and m1T in patients with bleeding peptic ulcers than in patients with non-bleeding peptic ulcers.

In conclusion, in patients with bleeding peptic ulcers, H pylori vacA s1a and m1T are less than those in patients with non-bleeding peptic ulcers.

ACKNOWLEDGEMENT

This study was supported by VGH 92-230, NSC-91-2314-B-075-127. We are in debt to Miss Betty, Tzu-en Lin for their assistance in this study.

References
1.  Dunn BE, Cohen H, Blaser MJ. Helicobacter pylori. Clin Microbiol Rev. 1997;10:720-741.  [PubMed]  [DOI]
2.  Blaser MJ. Ecology of Helicobacter pylori in the human stomach. J Clin Invest. 1997;100:759-762.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 189]  [Cited by in RCA: 170]  [Article Influence: 5.9]  [Reference Citation Analysis (1)]
3.  Olbe L, Fändriks L, Hamlet A, Svennerholm AM. Conceivable mechanisms by which Helicobacter pylori provokes duodenal ulcer disease. Baillieres Best Pract Res Clin Gastroenterol. 2000;14:1-12.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 15]  [Cited by in RCA: 14]  [Article Influence: 0.5]  [Reference Citation Analysis (0)]
4.  Dore MP, Graham DY. Pathogenesis of duodenal ulcer disease: the rest of the story. Baillieres Best Pract Res Clin Gastroenterol. 2000;14:97-107.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 17]  [Cited by in RCA: 18]  [Article Influence: 0.7]  [Reference Citation Analysis (0)]
5.  Henriksson AE, Edman AC, Nilsson I, Bergqvist D, Wadström T. Helicobacter pylori and the relation to other risk factors in patients with acute bleeding peptic ulcer. Scand J Gastroenterol. 1998;33:1030-1033.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 26]  [Cited by in RCA: 30]  [Article Influence: 1.1]  [Reference Citation Analysis (0)]
6.  Covacci A, Censini S, Bugnoli M, Petracca R, Burroni D, Macchia G, Massone A, Papini E, Xiang Z, Figura N. Molecular characterization of the 128-kDa immunodominant antigen of Helicobacter pylori associated with cytotoxicity and duodenal ulcer. Proc Natl Acad Sci USA. 1993;90:5791-5795.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 946]  [Cited by in RCA: 902]  [Article Influence: 27.3]  [Reference Citation Analysis (1)]
7.  Cover TL. The vacuolating cytotoxin of Helicobacter pylori. Mol Microbiol. 1996;20:241-246.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 220]  [Cited by in RCA: 191]  [Article Influence: 6.4]  [Reference Citation Analysis (0)]
8.  Ohmann C, Thon K, Hengels KJ, Imhof M. Incidence and pattern of peptic ulcer bleeding in a defined geographical area. DUSUK Study Group. Scand J Gastroenterol. 1992;27:571-581.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 18]  [Cited by in RCA: 17]  [Article Influence: 0.5]  [Reference Citation Analysis (0)]
9.  Wu CY, Poon SK, Chen GH, Chang CS, Yeh HZ. Interaction between Helicobacter pylori and non-steroidal anti-inflammatory drugs in peptic ulcer bleeding. Scand J Gastroenterol. 1999;34:234-237.  [PubMed]  [DOI]
10.  Cullen DJ, Hawkey GM, Greenwood DC, Humphreys H, Shepherd V, Logan RF, Hawkey CJ. Peptic ulcer bleeding in the elderly: relative roles of Helicobacter pylori and non-steroidal anti-inflammatory drugs. Gut. 1997;41:459-462.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 102]  [Cited by in RCA: 77]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
11.  Rokkas T, Karameris A, Mavrogeorgis A, Rallis E, Giannikos N. Eradication of Helicobacter pylori reduces the possibility of rebleeding in peptic ulcer disease. Gastrointest Endosc. 1995;41:1-4.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 167]  [Cited by in RCA: 140]  [Article Influence: 4.5]  [Reference Citation Analysis (4)]
12.  Jaspersen D, Koerner T, Schorr W, Brennenstuhl M, Raschka C, Hammar CH. Helicobacter pylori eradication reduces the rate of rebleeding in ulcer hemorrhage. Gastrointest Endosc. 1995;41:5-7.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 146]  [Cited by in RCA: 119]  [Article Influence: 3.8]  [Reference Citation Analysis (0)]
13.  Vaira D, Menegatti M, Miglioli M. What is the role of Helicobacter pylori in complicated ulcer disease. Gastroenterology. 1997;113:S78-S84.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 64]  [Cited by in RCA: 52]  [Article Influence: 1.8]  [Reference Citation Analysis (3)]
14.  Tu TC, Lee CL, Wu CH, Chen TK, Chan CC, Huang SH, Lee MS SC. Comparison of invasive and noninvasive tests for detecting Helicobacter pylori infection in bleeding peptic ulcers. Gastrointest Endosc. 1999;49:302-306.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 74]  [Cited by in RCA: 64]  [Article Influence: 2.4]  [Reference Citation Analysis (0)]
15.  Colin R, Czernichow P, Baty V, Touzé I, Brazier F, Bretagne JF, Berkelmans I, Barthélémy P, Hemet J. Low sensitivity of invasive tests for the detection of Helicobacter pylori infection in patients with bleeding ulcer. Gastroenterol Clin Biol. 2000;24:31-35.  [PubMed]  [DOI]
16.  Gisbert JP, Gonzalez L, de Pedro A, Valbuena M, Prieto B, Llorca I, Briz R, Khorrami S, Garcia-Gravalos R, Pajares JM. Helicobacter pylori and bleeding duodenal ulcer: prevalence of the infection and role of non-steroidal anti-inflammatory drugs. Scand J Gastroenterol. 2001;36:717-724.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 32]  [Cited by in RCA: 34]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
17.  Stack WA, Atherton JC, Hawkey GM, Logan RF, Hawkey CJ. Interactions between Helicobacter pylori and other risk factors for peptic ulcer bleeding. Aliment Pharmacol Ther. 2002;16:497-506.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 91]  [Cited by in RCA: 91]  [Article Influence: 3.8]  [Reference Citation Analysis (6)]
18.  Illies G, Reincke I, Nilius M, Dominguez-Munoz JE. Helicobacter pylori (HP) antibodies against cagA protein in bleeding and non-bleeding gastric and duodenal ulcers. Gastroenterology. 1996;110:A 141.  [PubMed]  [DOI]
19.  Van Doorn LJ, Figueiredo C, Mégraud F, Pena S, Midolo P, Queiroz DM, Carneiro F, Vanderborght B, Pegado MD, Sanna R. Geographic distribution of vacA allelic types of Helicobacter pylori. Gastroenterology. 1999;116:823-830.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 327]  [Cited by in RCA: 283]  [Article Influence: 10.5]  [Reference Citation Analysis (0)]
20.  van Doorn LJ, Figueiredo C, Sanna R, Pena S, Midolo P, Ng EK, Atherton JC, Blaser MJ, Quint WG. Expanding allelic diversity of Helicobacter pylori vacA. J Clin Microbiol. 1998;36:2597-2603.  [PubMed]  [DOI]
21.  Boom R, Sol CJ, Salimans MM, Jansen CL, Wertheim-van Dillen PM, van der Noordaa J. Rapid and simple method for purification of nucleic acids. J Clin Microbiol. 1990;28:495-503.  [PubMed]  [DOI]
22.  Atherton JC, Cao P, Peek RM, Tummuru MK, Blaser MJ, Cover TL. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific vacA types with cytotoxin production and peptic ulceration. J Biol Chem. 1995;270:17771-17777.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1186]  [Cited by in RCA: 1081]  [Article Influence: 34.9]  [Reference Citation Analysis (0)]
23.  van Doorn LJ, Figueiredo C, Sanna R, Plaisier A, Schneeberger P, de Boer W, Quint W. Clinical relevance of the cagA, vacA, and iceA status of Helicobacter pylori. Gastroenterology. 1998;115:58-66.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 433]  [Cited by in RCA: 406]  [Article Influence: 14.5]  [Reference Citation Analysis (0)]
24.  Yamaoka Y, Kodama T, Gutierrez O, Kim JG, Kashima K, Graham DY. Relationship between Helicobacter pylori iceA, cagA, and vacA status and clinical outcome: studies in four different countries. J Clin Microbiol. 1999;37:2274-2279.  [PubMed]  [DOI]
25.  Wang HJ, Kuo CH, Yeh AA, Chang PC, Wang WC. Vacuolating toxin production in clinical isolates of Helicobacter pylori with different vacA genotypes. J Infect Dis. 1998;178:207-212.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 60]  [Cited by in RCA: 55]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
26.  Parsonnet J. The incidence of Helicobacter pylori infection. Aliment Pharmacol Ther. 1995;9 Suppl 2:45-51.  [PubMed]  [DOI]
27.  Pounder RE, Ng D. The prevalence of Helicobacter pylori infection in different countries. Aliment Pharmacol Ther. 1995;9 Suppl 2:33-39.  [PubMed]  [DOI]
28.  Campbell S, Fraser A, Holliss B, Schmid J, O'Toole PW. Evidence for ethnic tropism of Helicobacter pylori. Infect Immun. 1997;65:3708-3712.  [PubMed]  [DOI]
29.  Malaty HM, Graham DY. Importance of childhood socioeconomic status on the current prevalence of Helicobacter pylori infection. Gut. 1994;35:742-745.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 283]  [Cited by in RCA: 270]  [Article Influence: 8.4]  [Reference Citation Analysis (0)]
30.  Lin CW, Wu SC, Lee SC, Cheng KS. Genetic analysis and clinical evaluation of vacuolating cytotoxin gene A and cytotoxin-associated gene A in Taiwanese Helicobacter pylori isolates from peptic ulcer patients. Scand J Infect Dis. 2000;32:51-57.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 16]  [Cited by in RCA: 18]  [Article Influence: 0.7]  [Reference Citation Analysis (0)]
31.  Pan ZJ, Berg DE, van der Hulst RW, Su WW, Raudonikiene A, Xiao SD, Dankert J, Tytgat GN, van der Ende A. Prevalence of vacuolating cytotoxin production and distribution of distinct vacA alleles in Helicobacter pylori from China. J Infect Dis. 1998;178:220-226.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 102]  [Cited by in RCA: 95]  [Article Influence: 3.4]  [Reference Citation Analysis (0)]
32.  Wong BC, Yin Y, Berg DE, Xia HH, Zhang JZ, Wang WH, Wong WM, Huang XR, Tang VS, Lam SK. Distribution of distinct vacA, cagA and iceA alleles in Helicobacter pylori in Hong Kong. Helicobacter. 2001;6:317-324.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 37]  [Cited by in RCA: 41]  [Article Influence: 1.6]  [Reference Citation Analysis (6)]
33.  Kim SY, Woo CW, Lee YM, Son BR, Kim JW, Chae HB, Youn SJ, Park SM. Genotyping CagA, VacA subtype, IceA1, and BabA of Helicobacter pylori isolates from Korean patients, and their association with gastroduodenal diseases. J Korean Med Sci. 2001;16:579-584.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 65]  [Cited by in RCA: 70]  [Article Influence: 2.8]  [Reference Citation Analysis (0)]
34.  Fukuta K, Azuma T, Ito Y, Suto H, Keida Y, Wakabayashi H, Watanabe A, Kuriyama M. Clinical relevance of cagE gene from Helicobacter pylori strains in Japan. Dig Dis Sci. 2002;47:667-674.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 7]  [Cited by in RCA: 6]  [Article Influence: 0.3]  [Reference Citation Analysis (0)]
35.  Figura N, Vindigni C, Covacci A, Presenti L, Burroni D, Vernillo R, Banducci T, Roviello F, Marrelli D, Biscontri M. cagA positive and negative Helicobacter pylori strains are simultaneously present in the stomach of most patients with non-ulcer dyspepsia: relevance to histological damage. Gut. 1998;42:772-778.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 66]  [Cited by in RCA: 64]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
36.  Figueiredo C, Van Doorn LJ, Nogueira C, Soares JM, Pinho C, Figueira P, Quint WG, Carneiro F. Helicobacter pylori genotypes are associated with clinical outcome in Portuguese patients and show a high prevalence of infections with multiple strains. Scand J Gastroenterol. 2001;36:128-135.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 90]  [Cited by in RCA: 87]  [Article Influence: 3.5]  [Reference Citation Analysis (0)]
37.  De Gusmão VR, Nogueira Mendes E, De Magalhães Queiroz DM, Aguiar Rocha G, Camargos Rocha AM, Ramadan Ashour AA, Teles Carvalho AS. vacA genotypes in Helicobacter pylori strains isolated from children with and without duodenal ulcer in Brazil. J Clin Microbiol. 2000;38:2853-2857.  [PubMed]  [DOI]
38.  Rudi J, Kolb C, Maiwald M, Kuck D, Sieg A, Galle PR, Stremmel W. Diversity of Helicobacter pylori vacA and cagA genes and relationship to VacA and CagA protein expression, cytotoxin production, and associated diseases. J Clin Microbiol. 1998;36:944-948.  [PubMed]  [DOI]
39.  van Leerdam ME, Tytgat GN. Review article: Helicobacter pylori infection in peptic ulcer haemorrhage. Aliment Pharmacol Ther. 2002;16 Suppl 1:66-78.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 31]  [Cited by in RCA: 28]  [Article Influence: 1.2]  [Reference Citation Analysis (0)]
Footnotes

Edited by Wang XL Proofread by Zhu LH

Write to the Help Desk