BPG is committed to discovery and dissemination of knowledge
Basic Research Open Access
©The Author(s) 2004. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Aug 15, 2004; 10(16): 2357-2360
Published online Aug 15, 2004. doi: 10.3748/wjg.v10.i16.2357
Effect of SNPs in protein kinase Cz gene on gene expression in the reporter gene detection system
Zhuo Liu, Hong-Xia Sun, Yong-Wei Zhang, Yun-Feng Li, Jin Zuo, Yan Meng, Fu-De Fang, National Laboratory of Medical Molecular Biology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing 100005, China
Author contributions: All authors contributed equally to the work.
Supported by the National High Technology Research and Development Program of China, No. 2002BA711A05, No. 2002BA711A10-02 and the National Natural Science Foundation of China, No. 30170441, No. 30370668 and the Natural Science Foundation of Beijing, No. 7032033 and the Foundation of Ministry of Education of China, No. 20030023020, No. 20010023024 Co-first-authors: Zhuo Liu and Yong-Wei Zhang
Correspondence to: Fu-De Fang, National Laboratory of Medical Molecular Biology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing 100005, China. fangfd@public3.bta.net.cn
Telephone: +86-10-65253005 Fax: +86-10-65253005
Received: December 10, 2003
Revised: January 4, 2004
Accepted: January 12, 2004
Published online: August 15, 2004

Abstract

AIM: To investigated the effects of the SNPs (rs411021, rs436045, rs427811, rs385039 and rs809912) on gene expression and further identify the susceptibility genes of type 2 diabetes.

METHODS: Ten allele fragments (49 bp each) were synthesized according to the 5 SNPs mentioned above. These fragments were cloned into luciferase reporter gene vector and then transfected into HepG2 cells. The activity of the luciferase was assayed. Effects of the SNPs on RNA splicing were analyzed by bioinformatics.

RESULTS: rs427811T allele and rs809912G allele enhanced the activity of the reporter gene expression. None of the 5 SNPs affected RNA splicing.

CONCLUSION: SNPs in protein kinase Cz (PKCZ) gene probably play a role in the susceptibility to type 2 diabetes by affecting the expression level of the relevant genes.




INTRODUCTION

Type 2 diabetes is a highly heterogeneous chronic disease characterized by metabolic disorder of blood glucose, its onset involves a number of susceptibility genes. Since 1996, locating and cloning the predisposing genes of type 2 diabetes, as well as the functional investigation, has become one of the hot spots worldwide in type 2 diabetes research. Based on genomic screening technology, it was reported firstly among Western population in succession that type 2 diabetes susceptibility genes located on different chromosomes[1-23]. The susceptibility genes were localized on chromosome 9 in Chinese population[24]. According to the case-control analysis in the region of 1p36.33-1p36.23, our research group found that one SNP locus, rs436045 in protein kinase Cz (PKCZ) gene, was linked to type 2 diabetes in Chinese population, and the haplotype block has been identified. While analyzing the haplotype which consists of the 5 SNPs (rs411021, rs436045, rs427811, rs385039, rs809912), we noticed that, in the case group, the haplotype CGTAG showed a significantly higher frequency than that in control group, whereas the frequency of haplotype TAGGA decreased significantly (P < 0.01, OR = 1.625), it implied that the changes of those haplotypes related to the onset of type 2 diabetes in Chinese[25]. However, it is still unclear weather haplotypes play a role during the episode of the disease.

To determine the biological function of those haplotypes, we investigated their influence on gene expression by bioinformatics approach and reporter gene activity determination system, which would provide a basis for further research.

In the previous work, we found that the 5 SNPs at the introns of PKCZ gene located in the same haplotype block in case group, and the haplotype they formed was clearly associated with type 2 diabetes mellitus. In order to determine the susceptibility loci associated with type 2 diabetes, we performed functional analysis on 5 SNPs.

MATERIALS AND METHODS
Identification of SNPs in the coding region of PKCZ gene

Coding region (from exon 4 to exon 13 or from rs1878745 to rs262642) of PKCZ gene was investigated for SNPs (cSNP) by sequencing. Ten unrelated type 2 diabetic patients and 10 control subjects from Han population in China were enrolled in a case-control study. Primers were designed by Primer 3.0 program (http://zeno.well.ox.ac.uk:8080/gitbin/ primer3_http://www.cgi) and each PCR product was limited within about 500 base pairs. The sequencing results from ABI377 sequencer were analyzed through PhredPhrap/consed program to identify functional SNPs.

Analysis of the effect of 5 intron SNPs on mRNA splicing

The distance from the SNP to the splicing point in exon was determined based on the published genome sequence. According to this information, we preliminarily estimated whether the SNP site influences gene splicing.

Search of the information on PKC family member

The location and sequence of other PKC family members were obtained by means of bioinformatics. Then, different spliceosomes from other family members residing in the sequence of PKCZ were analyzed.

Analysis of the introns where 5 SNPs located

Each SNP and the intron sequence around the loci were compared with the data in cDNA database (http://www.sanbi.ac.za) to reveal the sequence homology. The open reading frames in this sequence were analyzed, and then the amino acid was blast using the (http://www.ncbi.nlm.nih.gov) protein database in search of the sequence homology.

Effects of SNPs on gene expression by transient transfection

Ten alleles corresponding to the 5 SNPs in PKCZ gene were cloned into pGL3-promoter vector in the direction from 5’ to 3’ (Table 1). Meanwhile, HepG2 cells were cultured with DMEM (Gibco, LOS angeles, USA) containing 100 mL/L fetal bovine serum. Then, the cells (1.5 × 10 5-2 × 10 5) were transfected with pGL3-promoter vector (1 uL) or recombinant vector with Lipofectamine transfection reagent (Promega, madison, USA). The transfection rate was assayed by using pRL-SV40 DNA (100 ng, Promega, madison, USA) as an internal control. Forty-eight hours post transfection, the luciferase activity was determined by the Dual-Luciferase® Reporter Assay System using pRL-SV40 as an internal control.

Table 1 Sequence of ten 49-bp fragments containing each al-lele of 5 SNPs.
Fragment nameSequence
rs809912G-forward5’ ggggtaccccagccatcctccacc c gcccattctccatcc 3’
rs809912G-reverse3’ gtcggtaggaggtgg g cgggtaagaggtaggttctagaag 5’
rs809912A-forward5’ ggggtaccccagccatcctccacc t gcccattctccatcc 3’
rs809912A-reverse3’ ggggtaccccagccatcctccacc a gcccattctccatcc 5’
rs436045A-forward5’ ggggtacccagcagtgcctgtcag a tttggtccaagcagt 3’
rs436045A-reverse3’ tcgtcacggacagtc t aaaccaggttcgtcactctagaag 5’
rs436045G-forward5’ ggggtacccagcagtgcctgtcag g tttggtccaagcagt 3’
rs436045G-reverse3’ tcgtcacggacagtc c aaaccaggttcgtcactctagaag 5’
rs427811T-forward5’ ggggtaccgctcagtgtcctcttt t gagaaggtataggtg 3’
rs427811T-reverse3’ gagtcacaggagaaa a ctcttccatatccacatctagaag 5’
rs427811G-forward5’ ggggtaccgctcagtgtcctcttt g gagaaggtacaggtg 3’
rs427811G-reverse3’ gagtcacaggagaaa c ctcttccatgtccacatctagaag 5’
rs385039G-forward5’ ggggtacctgtttacagaagctac g ttgtaacacctgctc 3’
rs385039G-reverse3’ caaatgtcttcgatg c aacattgtggacgagatctagaag 5’
rs385039A-forward5’ ggggtacctgtttacagaagctac a ttgtaacacctgctc 3’
rs385039A-reverse3’ caaatgtcttcgatg t aacattgtggacgagatctagaag 5’
rs411021C-forward5’ ggggtaccgggggttgcggtgagc c gagattgtgccactg 3’
rs411021C-reverse3’ ccccaacgccactcg g ctctaacacggtgacctctagaag 5’
rs411021T-forward5’ ggggtaccgggggttgcggtgagc t gagattgtgccactg 3’
rs411021T-reverse3’ ccccaacgccactcg a ctctaacacggtgacctctagaag 5’
RESULTS
SNPs in the coding region of PKCZ gene

While seeking for functional SNPs by sequencing the exons around the 13 intron SNPs discovered in the previous work, we found no new ones except for the rs1878745 corresponding to NCBI database. It suggested that the disease loci probably did not exist in the coding region.

Influence of positive SNP on the PKCZ gene expression

To locate the disease SNP, we investigated the effect of the 5 positive SNPs (rs411021, rs436045, rs427811, rs385039, and rs809912) lying in the same haplotype block on PKCZ gene expression. The influence of the 5 SNPs over RNA splicing was evaluated since all the 5 SNPs lay in the introns. The distance of the SNPs from the upstream and downstream of the splicing site are respectively as the following: rs411021 (3535 bp, 5283 bp), rs436045 (4770 bp, 4048 bp), rs427811 (8729 bp, 89 bp), rs385039 (1629 bp, 57 bp), and rs809912 ( > 2 kb, 2057 bp). Those are comparatively long distant to 5’ splice donor site, 3’ receptor site and the internal vertex, suggesting that they have little association with pre-mRNA splicing. In addition, we estimated if differential splicing occurs between PKCZ gene and other PKC family members. Although there are at least 11 family members besides PKCZ, none of them locate on chromosome 1, which negates the ‘differential splicing supposition’. The location of introns where 5 SNPs located was analyzed. As a first step, we compared the intron sequence around the loci of each of the 5 SNPs with the data in cDNA database (http://www. sanbi.ac.za) in order to reveal the sequence homology. Result showed that the introns had no coding function because neither cDNA sequence homology nor protein sequence homology by ORF analysis was found. But this result needs to be further confirmed by Northern blotting. And finally, the effects of the SNPs on gene expression were investigated. Transfected HepG2 cell containing pGL3-promoter reporter gene vector was used to detect the activity of the reporter gene that could reflect indirectly whether the fragment inserted affected gene expression. Statistical analysis showed a significant difference between the two SNPs of rs4278111 and rs809912. In rs4278111, the reporter gene activity of T allele was 1.5 times that of the G allele, while in rs809912, in G allele it was 1.7 times that of A allele (Table 2). Therefore, these two SNPs will probably affect the expression level of PKCZ gene.

Table 2 Transcriptional regulatory activity of each construct of PKCZ in HepG2 cells.
ConstructRelative luciferase activityP
pGL3-promoter0.3533 ± 0.040
pGL3-rs411021C0.5167 ± 0.064
pGL3-rs411021T0.5100 ± 0.1020.928
pGL3-rs436045A0.3433 ± 0.051
pGL3-rs436045G0.3767 ± 0.0230.363
pGL3-rs427811T0.6233 ± 0.064a
pGL3-rs427811G0.4433 ± 0.0680.029
pGL3-rs385039A0.3500 ±0.044
pGL3-rs385039G0.3467 ±0.0150.907
pGL3-rs809912A0.1800 ± 0.017a
pGL3-rs809912G0.3033 ± 0.0420.009
DISCUSSION

PKCZ is a member of serine/threonine protein kinase family, belonging to atypical PKC, and independent of both calcium and diacylglycerol (DAG)[26]. It is insensitive to PKC inhibitors and cannot be activated by phorbol ester. PKCZ protein is thought to function downstream of phosphatidylinositol 3-kinase (PI 3-kinase) in insulin signaling pathway and plays a role in promoting the translocation and activation of GluT4 from the cytosol to membranes which will accelerate the glucose transport in skeletal muscle and adipocytes[27-30]. In addition, PKCZ can induce negative feedback to the signaling pathway through phosphorylating IRS-1[31,32]. Insulin-stimulated glucose transport is defective in type 2 diabetes mellitus, and this defect can be ameliorated via correcting PRKC-zeta/lambda activation defect[33], suggesting that the transport deficiency is at least partly associated with the activation defect of PKCZ. Our previous research showed that PKCZ is related to susceptibility to type 2 diabetes mellitus in Chinese population. If so, whether genetic polymorphism of PKCZ gene will influence the pathways associated with blood glucose regulation by affecting its gene expression, and increase the susceptibility to this disease ultimately? Based on bioinformatics research and reporter gene activity determination system, our data provide first evidence that intron SNP loci in PKCZ gene affect gene expression. Horikawa[34] has reported that gene expression was under the influence of the 3 intron SNPs in CAPN10 gene, the susceptibility gene of type 2 diabetes in Mexican American. Such kind of result was also reported by other groups, for example, an SNP in COL1N1 gene can change the binding site of transcription factor Sp1 thereby influencing the gene expression, resulting in the decline of bone density as well as osteoporosis[35].

In our experiment, we found the two alleles (rs427811T and rs809912G) that had a relatively high frequency in type 2 diabetic patients could improve the reporter gene expression, apparently in conflict with our predicted result. This phenomenon might be explained by the hypothesis that PKCZ gene was involved in other signaling pathways and its relation to the disease was more complicated than we had estimated. Till now, there have been no reports that PKCZ gene expression is changed in the tissues of type 2 diabetic patients. But PED/PEA-15, a substrate of PKC, was reported to increase PKCZ gene expression in the patient’s tissues[36], which inhibited insulin stimulated glucose transportation. Thus, the high expression of PED/PEA-15 gene probably plays a role in insulin resistance of type 2 diabetes. Our next goals are to determine whether PKCZ interacts with PED/PEA-15 in insulin signaling pathway, and whether PED/ PEA-15 or its analogue is involved in the inhibition of the insulin stimulated glucose transport via another signal pathway.

References
1.  Hanis CL, Boerwinkle E, Chakraborty R, Ellsworth DL, Concannon P, Stirling B, Morrison VA, Wapelhorst B, Spielman RS, Gogolin-Ewens KJ. A genome-wide search for human non-insulin-dependent (type 2) diabetes genes reveals a major susceptibility locus on chromosome 2. Nat Genet. 1996;13:161-166.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 408]  [Cited by in RCA: 360]  [Article Influence: 12.0]  [Reference Citation Analysis (0)]
2.  Mahtani MM, Widén E, Lehto M, Thomas J, McCarthy M, Brayer J, Bryant B, Chan G, Daly M, Forsblom C. Mapping of a gene for type 2 diabetes associated with an insulin secretion defect by a genome scan in Finnish families. Nat Genet. 1996;14:90-94.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 217]  [Cited by in RCA: 204]  [Article Influence: 6.8]  [Reference Citation Analysis (0)]
3.  Ghosh S, Watanabe RM, Hauser ER, Valle T, Magnuson VL, Erdos MR, Langefeld CD, Balow J, Ally DS, Kohtamaki K. Type 2 diabetes: evidence for linkage on chromosome 20 in 716 Finnish affected sib pairs. Proc Natl Acad Sci U S A. 1999;96:2198-2203.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 171]  [Cited by in RCA: 163]  [Article Influence: 6.0]  [Reference Citation Analysis (0)]
4.  Vionnet N, Hani EH, Dupont S, Gallina S, Francke S, Dotte S, De Matos F, Durand E, Leprêtre F, Lecoeur C. Genomewide search for type 2 diabetes-susceptibility genes in French whites: evidence for a novel susceptibility locus for early-onset diabetes on chromosome 3q27-qter and independent replication of a type 2-diabetes locus on chromosome 1q21-q24. Am J Hum Genet. 2000;67:1470-1480.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 505]  [Cited by in RCA: 510]  [Article Influence: 19.6]  [Reference Citation Analysis (0)]
5.  Elbein SC, Hoffman MD, Teng K, Leppert MF, Hasstedt SJ. A genome-wide search for type 2 diabetes susceptibility genes in Utah Caucasians. Diabetes. 1999;48:1175-1182.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 234]  [Cited by in RCA: 228]  [Article Influence: 8.4]  [Reference Citation Analysis (0)]
6.  Watanabe RM, Ghosh S, Langefeld CD, Valle TT, Hauser ER, Magnuson VL, Mohlke KL, Silander K, Ally DS, Chines P. The Finland-United States investigation of non-insulin-dependent diabetes mellitus genetics (FUSION) study. II. An autosomal genome scan for diabetes-related quantitative-trait loci. Am J Hum Genet. 2000;67:1186-1200.  [PubMed]  [DOI]
7.  Wiltshire S, Hattersley AT, Hitman GA, Walker M, Levy JC, Sampson M, O'Rahilly S, Frayling TM, Bell JI, Lathrop GM. A genomewide scan for loci predisposing to type 2 diabetes in a U.K. population (the Diabetes UK Warren 2 Repository): analysis of 573 pedigrees provides independent replication of a susceptibility locus on chromosome 1q. Am J Hum Genet. 2001;69:553-569.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 247]  [Cited by in RCA: 237]  [Article Influence: 9.5]  [Reference Citation Analysis (15)]
8.  Permutt MA, Wasson JC, Suarez BK, Lin J, Thomas J, Meyer J, Lewitzky S, Rennich JS, Parker A, DuPrat L. A genome scan for type 2 diabetes susceptibility loci in a genetically isolated population. Diabetes. 2001;50:681-685.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 107]  [Cited by in RCA: 101]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
9.  Lindgren CM, Mahtani MM, Widén E, McCarthy MI, Daly MJ, Kirby A, Reeve MP, Kruglyak L, Parker A, Meyer J. Genomewide search for type 2 diabetes mellitus susceptibility loci in Finnish families: the Botnia study. Am J Hum Genet. 2002;70:509-516.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 108]  [Cited by in RCA: 112]  [Article Influence: 4.7]  [Reference Citation Analysis (0)]
10.  Busfield F, Duffy DL, Kesting JB, Walker SM, Lovelock PK, Good D, Tate H, Watego D, Marczak M, Hayman N. A genomewide search for type 2 diabetes-susceptibility genes in indigenous Australians. Am J Hum Genet. 2002;70:349-357.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 71]  [Cited by in RCA: 60]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
11.  Demenais F, Kanninen T, Lindgren CM, Wiltshire S, Gaget S, Dandrieux C, Almgren P, Sjögren M, Hattersley A, Dina C. A meta-analysis of four European genome screens (GIFT Consortium) shows evidence for a novel region on chromosome 17p11.2-q22 linked to type 2 diabetes. Hum Mol Genet. 2003;12:1865-1873.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 53]  [Cited by in RCA: 52]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
12.  Lakka TA, Rankinen T, Weisnagel SJ, Chagnon YC, Rice T, Leon AS, Skinner JS, Wilmore JH, Rao DC, Bouchard C. A quantitative trait locus on 7q31 for the changes in plasma insulin in response to exercise training: the HERITAGE Family Study. Diabetes. 2003;52:1583-1587.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 35]  [Cited by in RCA: 35]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
13.  Daimon M, Ji G, Saitoh T, Oizumi T, Tominaga M, Nakamura T, Ishii K, Matsuura T, Inageda K, Matsumine H. Large-scale search of SNPs for type 2 DM susceptibility genes in a Japanese population. Biochem Biophys Res Commun. 2003;302:751-758.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 29]  [Cited by in RCA: 26]  [Article Influence: 1.1]  [Reference Citation Analysis (0)]
14.  Laivuori H, Lahermo P, Ollikainen V, Widen E, Häivä-Mällinen L, Sundström H, Laitinen T, Kaaja R, Ylikorkala O, Kere J. Susceptibility loci for preeclampsia on chromosomes 2p25 and 9p13 in Finnish families. Am J Hum Genet. 2003;72:168-177.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 106]  [Cited by in RCA: 91]  [Article Influence: 4.0]  [Reference Citation Analysis (4)]
15.  Thameem F, Yang X, Permana PA, Wolford JK, Bogardus C, Prochazka M. Evaluation of the microsomal glutathione S-transferase 3 (MGST3) locus on 1q23 as a Type 2 diabetes susceptibility gene in Pima Indians. Hum Genet. 2003;113:353-358.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 12]  [Cited by in RCA: 18]  [Article Influence: 0.8]  [Reference Citation Analysis (0)]
16.  Reynisdottir I, Thorleifsson G, Benediktsson R, Sigurdsson G, Emilsson V, Einarsdottir AS, Hjorleifsdottir EE, Orlygsdottir GT, Bjornsdottir GT, Saemundsdottir J. Localization of a susceptibility gene for type 2 diabetes to chromosome 5q34-q35.2. Am J Hum Genet. 2003;73:323-335.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 141]  [Cited by in RCA: 122]  [Article Influence: 5.3]  [Reference Citation Analysis (0)]
17.  van Tilburg JH, Sandkuijl LA, Strengman E, van Someren H, Rigters-Aris CA, Pearson PL, van Haeften TW, Wijmenga C. A genome-wide scan in type 2 diabetes mellitus provides independent replication of a susceptibility locus on 18p11 and suggests the existence of novel Loci on 2q12 and 19q13. J Clin Endocrinol Metab. 2003;88:2223-2230.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 48]  [Cited by in RCA: 44]  [Article Influence: 1.9]  [Reference Citation Analysis (1)]
18.  Duggirala R, Almasy L, Blangero J, Jenkinson CP, Arya R, DeFronzo RA, Stern MP, O'Connell P. Further evidence for a type 2 diabetes susceptibility locus on chromosome 11q. Genet Epidemiol. 2003;24:240-242.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 14]  [Cited by in RCA: 13]  [Article Influence: 0.6]  [Reference Citation Analysis (0)]
19.  Frayling TM, Wiltshire S, Hitman GA, Walker M, Levy JC, Sampson M, Groves CJ, Menzel S, McCarthy MI, Hattersley AT. Young-onset type 2 diabetes families are the major contributors to genetic loci in the Diabetes UK Warren 2 genome scan and identify putative novel loci on chromosomes 8q21, 21q22, and 22q11. Diabetes. 2003;52:1857-1863.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 36]  [Cited by in RCA: 39]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
20.  Duggirala R, Almasy L, Blangero J, Jenkinson CP, Arya R, DeFronzo RA, Stern MP, O'Connell P. Further evidence for a type 2 diabetes susceptibility locus on chromosome 11q. Genet Epidemiol. 2003;24:240-242.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 14]  [Cited by in RCA: 13]  [Article Influence: 0.6]  [Reference Citation Analysis (0)]
21.  Hsueh WC, St Jean PL, Mitchell BD, Pollin TI, Knowler WC, Ehm MG, Bell CJ, Sakul H, Wagner MJ, Burns DK. Genome-wide and fine-mapping linkage studies of type 2 diabetes and glucose traits in the Old Order Amish: evidence for a new diabetes locus on chromosome 14q11 and confirmation of a locus on chromosome 1q21-q24. Diabetes. 2003;52:550-557.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 110]  [Cited by in RCA: 111]  [Article Influence: 4.8]  [Reference Citation Analysis (0)]
22.  Kim SH, Ma X, Klupa T, Powers C, Pezzolesi M, Warram JH, Rich SS, Krolewski AS, Doria A. Genetic modifiers of the age at diagnosis of diabetes (MODY3) in carriers of hepatocyte nuclear factor-1alpha mutations map to chromosomes 5p15, 9q22, and 14q24. Diabetes. 2003;52:2182-2186.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 34]  [Cited by in RCA: 36]  [Article Influence: 1.6]  [Reference Citation Analysis (1)]
23.  Sellick GS, Garrett C, Houlston RS. A novel gene for neonatal diabetes maps to chromosome 10p12.1-p13. Diabetes. 2003;52:2636-2638.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 27]  [Cited by in RCA: 29]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
24.  Luo TH, Zhao Y, Li G, Yuan WT, Zhao JJ, Chen JL, Huang W, Luo M. A genome-wide search for type II diabetes susceptibility genes in Chinese Hans. Diabetologia. 2001;44:501-506.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 88]  [Cited by in RCA: 89]  [Article Influence: 3.6]  [Reference Citation Analysis (0)]
25.  Li YF, Sun HX, Wu GD, Du WN, Zuo J, Shen Y, Qiang BQ, Yao ZJ, Wang H, Huang W. Protein kinase C/zeta (PRKCZ) gene is associated with type 2 diabetes in Han population of North China and analysis of its haplotypes. World J Gastroenterol. 2003;9:2078-2082.  [PubMed]  [DOI]
26.  Nishizuka Y. Protein kinase C and lipid signaling for sustained cellular responses. FASEB J. 1995;9:484-496.  [PubMed]  [DOI]
27.  Standaert ML, Galloway L, Karnam P, Bandyopadhyay G, Moscat J, Farese RV. Protein kinase C-zeta as a downstream effector of phosphatidylinositol 3-kinase during insulin stimulation in rat adipocytes. Potential role in glucose transport. J Biol Chem. 1997;272:30075-30082.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 343]  [Cited by in RCA: 339]  [Article Influence: 11.7]  [Reference Citation Analysis (0)]
28.  Standaert ML, Bandyopadhyay G, Perez L, Price D, Galloway L, Poklepovic A, Sajan MP, Cenni V, Sirri A, Moscat J. Insulin activates protein kinases C-zeta and C-lambda by an autophosphorylation-dependent mechanism and stimulates their translocation to GLUT4 vesicles and other membrane fractions in rat adipocytes. J Biol Chem. 1999;274:25308-25316.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 158]  [Cited by in RCA: 164]  [Article Influence: 6.1]  [Reference Citation Analysis (0)]
29.  Etgen GJ, Valasek KM, Broderick CL, Miller AR. In vivo adenoviral delivery of recombinant human protein kinase C-zeta stimulates glucose transport activity in rat skeletal muscle. J Biol Chem. 1999;274:22139-22142.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 49]  [Cited by in RCA: 46]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
30.  Tremblay F, Lavigne C, Jacques H, Marette A. Defective insulin-induced GLUT4 translocation in skeletal muscle of high fat-fed rats is associated with alterations in both Akt/protein kinase B and atypical protein kinase C (zeta/lambda) activities. Diabetes. 2001;50:1901-1910.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 166]  [Cited by in RCA: 172]  [Article Influence: 6.9]  [Reference Citation Analysis (0)]
31.  Ravichandran LV, Esposito DL, Chen J, Quon MJ. Protein kinase C-zeta phosphorylates insulin receptor substrate-1 and impairs its ability to activate phosphatidylinositol 3-kinase in response to insulin. J Biol Chem. 2001;276:3543-3549.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 178]  [Cited by in RCA: 173]  [Article Influence: 6.9]  [Reference Citation Analysis (0)]
32.  Liu YF, Paz K, Herschkovitz A, Alt A, Tennenbaum T, Sampson SR, Ohba M, Kuroki T, LeRoith D, Zick Y. Insulin stimulates PKCzeta -mediated phosphorylation of insulin receptor substrate-1 (IRS-1). A self-attenuated mechanism to negatively regulate the function of IRS proteins. J Biol Chem. 2001;276:14459-14465.  [PubMed]  [DOI]
33.  Kanoh Y, Bandyopadhyay G, Sajan MP, Standaert ML, Farese RV. Rosiglitazone, insulin treatment, and fasting correct defective activation of protein kinase C-zeta/lambda by insulin in vastus lateralis muscles and adipocytes of diabetic rats. Endocrinology. 2001;142:1595-1605.  [PubMed]  [DOI]
34.  Horikawa Y, Oda N, Cox NJ, Li X, Orho-Melander M, Hara M, Hinokio Y, Lindner TH, Mashima H, Schwarz PE. Genetic variation in the gene encoding calpain-10 is associated with type 2 diabetes mellitus. Nat Genet. 2000;26:163-175.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1071]  [Cited by in RCA: 922]  [Article Influence: 35.5]  [Reference Citation Analysis (0)]
35.  Uitterlinden AG, Burger H, Huang Q, Yue F, McGuigan FE, Grant SF, Hofman A, van Leeuwen JP, Pols HA, Ralston SH. Relation of alleles of the collagen type Ialpha1 gene to bone density and the risk of osteoporotic fractures in postmenopausal women. N Engl J Med. 1998;338:1016-1021.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 297]  [Cited by in RCA: 253]  [Article Influence: 9.0]  [Reference Citation Analysis (27)]
36.  Condorelli G, Vigliotta G, Iavarone C, Caruso M, Tocchetti CG, Andreozzi F, Cafieri A, Tecce MF, Formisano P, Beguinot L. PED/PEA-15 gene controls glucose transport and is overexpressed in type 2 diabetes mellitus. EMBO J. 1998;17:3858-3866.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 129]  [Cited by in RCA: 129]  [Article Influence: 4.6]  [Reference Citation Analysis (0)]
Footnotes

Co-correspondents: Yan Meng and Fu-De Fang

Edited by Zhu LH and Chen WW Proofread by Xu FM

Write to the Help Desk