BPG is committed to discovery and dissemination of knowledge
Viral Hepatitis Open Access
©The Author(s) 2004. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. May 15, 2004; 10(10): 1436-1439
Published online May 15, 2004. doi: 10.3748/wjg.v10.i10.1436
Effect of Hejie decoction on T cell immune state of chronic hepatitis B patients
Shi-Jun Zhang, Ze-Xiong Chen, Department of Traditional Chinese Medicine, First Affiliated Hospital, Sun Yat-Sen University, Guangzhou 510080, Guangdong Province, China
Shao-Xian Lao, Institute of Digestive Diseases, Traditional Chinese Medicine University of Guangzhou, Guangzhou 510405, Guangdong Province, China
Bi-Jun Huang, Institute of Cancer, Sun Yat-Sen University, Guangzhou 510080, Guangdong Province, China
Author contributions: All authors contributed equally to the work.
Supported by Guangdong Administrative Bureau of TCM and Chinese Drugs, No.98374 and No.100108
Correspondence to: Shi-Jun Zhang, Department of Traditional Chinese Medicine, First Affiliated Hospital, Sun Yat-Sen University, Guangzhou 510080, Guangdong Province, China. zhsjun1967@hotmail.com
Telephone: +86-20-87334505 Fax: +86-20-87334505
Received: August 6, 2003
Revised: August 24, 2003
Accepted: September 1, 2003
Published online: May 15, 2004

Abstract

AIM: To explore the effect of Hejie decoction (HJD) (mediation decoction) on T cellular immune state of chronic hepatitis B patients.

METHODS: Sixty-five patients with chronic hepatitis B were randomly divided into 2 groups. Forty patients in the treatment group were treated by HJD, and 25 patients in the control group were treated by routine Western medicine. The TCRVβ7 gene expression, T lymphocyte subsets (CD3+, CD4+, CD8+, CD4+/CD8+) levels were observed before and after treatment.

RESULTS: The level of CD4+ cells was lower whereas the level of CD8+ cells was higher in patients than in the normal group. There was no significant difference between the levels of CD3+ cells in patients and normal persons. After 6 months of treatment, ALT, AST, TB levels of the 2 groups were obviously decreased, and the level of CD4+ cells was increased whereas the level of CD8+ cells was decreased in the treatment group. However, the level of CD4+ cells and CD8+ cells had no significant difference in the control group. TCRVβ7 expressions were detected in 6 patients of the treatment group, whose HBV-DNA and HBeAg turned negative and ALT became normal. HBeAg in another 3 patients turned negative while HBV-DNA did not, and TCRVβ7 expressions were not detectable. TCRVβ7 expression could not be detected in the control group, HBV-DNA of the control group did not turn negative. HBeAg in 1 patient turned negative while HBV-DNA did not, and TCRVβ7 expressions were not detectable. The total effective rate was not significantly different between the 2 groups and the markedly effective rate was significantly different (P < 0.01).

CONCLUSION: HJD is effective for treating chronic hepatitis B, and its effect seems to relate with the improvement of the TCRVβ7 expression of chronic hepatitis B patients, thus activating T cells and eliminating HBV. T cellular immune function plays an important role in HBV infection and virus elimination.




INTRODUCTION

T cells take charge of recognizing the cells infected with bacilli and virus, as well as cancer cells[1]. Recent studies have demonstrated that the stimulating signal would be transferred to the inside of cells by CD3 molecules when antigens are recognized by T cell receptor (TCR), sequentially activating T lymphocyte cells. TCR plays a crucial role in exerting T cellular immune function. Therefore it is very important to investigate the relation of T cellular function and clinical effect by studying the function of T cell receptor[2-4]. We treated chronic hepatitis B patients with HJD from June 1999 to March 2003, and observed the relation between clinical effects and T lymphocyte subsets, TCRVβ7 gene expression. The results are reported as follows.

MATERIALS AND METHODS
Materials

All the 65 patients with chronic hepatitis B enrolled were outpatients from the special clinics of liver diseases, and were divided into 2 groups according to random number table. The 40 patients in the treatment group were 22 males and 18 females, aged 18-60 years, averaged 38.6 ± 9.8 years, with an average course of illness of 0.8-12.5, 3.5 ± 1.2 years. The 25 patients in the control group were 14 males and 11 females, aged 18-60 years, averaged 39.0 ± 8.9 years, with an average course of illness of 0.6-11.1, 3.2 ± 1.1 years. The difference of clinical data between the 2 groups was insignificant, so the 2 groups were comparable. Ten age-matched healthy donors from the Blood Center of our hospital were assigned as normal group.

Diagnostic criteria

The patient had a history of hepatitis B or HBsAg carrier for at least 6 mo and still had the symptoms and signs of hepatitis and abnormal liver function at the time when they were included in the trial. Their HBsAg, HBeAg and HBVDNA were positive.

Criteria of enrollment

The patients were aged 18-60 years, their serum levels of alanine aminotransferase (ALT) were between 80 U/L and 240 U/L, their serum HBeAg and HBV-DNA (quantitative PCR) were positive. The diagnostic criteria of hepatitis B were in accordance with the standards for chronic viral hepatitis issued in the Fifth National Conference on Infectious Diseases and Parasitosis in China (Beijing, China, 1995)[5].

Criteria of exclusion

The patients who were over 60, or less than 18 years old, and those who were pregnant or in breast-feeding period, those who were complicated with hepatitis C or other hepatic viral infection, suspicious of autoimmune hepatitis, and drug hepatitis or alcoholic hepatitis, as well as those who had severe complications of cardiovascular, renal or hematopoietic systems and mental diseases were excluded from the trial.

Methods

The treatment group was treated with Hejie decoction, consisting of Radix Bupleuri 10 g, Radix Scutellariae 12 g, Rhizoma Pinelliae 9 g, Radix Codonopsis Pilosulae 30 g, Radix Glycyrrhizae Praeparata 6 g, Fructus Ziziphi Jujubae 9 g, Rhizoma Polygoni Cuspidati 30 g, Radix Morindae Officinalis 8 g, Herba Hedyotis Diffusae 30 g. One dose was taken per day for 6 mo. The control group was treated with compound vitamin B2, 2 tablets, vitamine C 100 mg, vitamine E 50 mg, Wuzhi capsules, 2 tablets, 3 times a day for 6 mo. Patients who had normal serum ALT, HBeAg and HBV DNA (quantitative PCR) after treatment were defined as responders, while those with negative results were taken as non-responders.

Patients' symptoms and signs were recorded in detail using “Clinical Observation Table” once a month before and during the treatment. HBV-M and anti-HAV, anti-HCV, anti-HDV and anti-EBV marks: Enzyme linked immunosorbent assay (ELISA) kit was obtained from Shanghai Kehua Corporation. HBV-DNA: Quantitative polymerized chain reaction (PCR) kit was from Diagnostic Center of Sun Yat-Sen University.

The patients had liver function examination (American Experiment Instrument Corporation) every month during the treatment, including contents of serum proteins, total bilirubin (TB), and activities of ALT and AST (aspartate aminotransferase). The kit was a product of American Experiment Instrument Corporation.

T-lymphocyte subsets were detected using single clone antibody APAAP method, the kits were purchased from Wuhan Boster Biological Technology Co. Ltd.

Peripheral blood mononuclear cells (PBMC) were prepared from 8 mL of freshly, heparinized blood by centrifugation at 400 r/min through a Ficoll-hypaque density gradient, washed 3 times with 10 g/L BSA in PBS and resuspended in 5 g/L BSA in PBS, stored on ice or at -70 °C for extraction of RNA.

Total cellular RNA was extracted from fresh PBMC with acid guanidinium thiocyanate-phenol-chloroform extraction according to the manufacturer’s instructions, RNAgens were purchased from Promega Corporation.

The primers were synthesized on an applied biosystems DNA synthesizer(Shanghai Shenggong Company, China), and the sequences[6] were (5’-3’): CCTGAATGCCCCAACAGCTCTC, expanding length: 235. β-actin was prepared as an internal standard to quantify the products. Three micrograms of total RNA was used to synthesize first-strand cDNA. RT-PCR was carried out according to the manufacturer’s instructions (Promega, USA). The amplified products were then electrophoresed on 20 g/L agarose gel. The electrophoresis images were scanned by Fluor-S MultiImager (Bio-Rad, USA) and analyzed according to the Vβ/β-actin ratios by computing densitometer and Image Quant software.

Statistical analysis

All statistics were performed by using statistical procedure of social science (SPSS), including chi-square test and Wilcoson rank sum test. The probability values less than 0.05 were considered significant.

RESULTS
Standard for efficacy evaluation

The clinical efficacy of treatment was evaluated according to the following standards formulated by authors: (1) Markedly effective: Chief symptoms including right upper abdomen pain, poor appetite and abdominal distention disappeared, HBeAg and HBV-DNA turned negative, serum levels of ALT, AST, TBIL restored to normal. (2) Effective: Chief symptoms were alleviated or improved, the level of HBV-DNA decreased, HBeAg did not turn negative, serum levels of ALT, AST, TBIL decreased by > 1/2 of the original levels. (3) Ineffective: Neither the chief symptoms nor the serum levels of ALT, AST and TBIL or HBeAg, HBV-DNA showed any improvement.

Clinical efficacy of treatment

In the treated group, the treatment was markedly effective in 6 cases, effective in 33 and ineffective in 1, the total effective rate was 97.5%. In the control group, the treatment was markedly effective in 0 cases, effective in 22 and ineffective in 3, the total effective rate was 88.0%. The difference of total effective rate was insignificant between the 2 groups (P > 0.05) and that of markedly effective rate was significant (P < 0.01).

ALT, AST, TB and HBVDNA levels before and after treatment, as well as TCRVβ7 gene expression

After 6 mo of treatment, the ALT, AST, TB levels of the 2 groups were obviously decreased (P < 0.01), HBVDNA levels of the treatment group were obviously decreased (P < 0.05, Table 1). TCRVβ7 expressions were detected in 6 patients of the treated group, and their HBV-DNA and HBeAg turned negative, and HBeAg in another 3 patients turned negative, but HBV-DNA did not turn negative, and TCRVβ7 expressions were not detectable. The TCRVβ7 expression could not be detected in the control group, HBV-DNA of the control group did not turn negative. HBeAg in 1 patient turned negative in the control group, but HBV-DNA did not turn negative, and TCRVβ7 expressions were not detectable. In patients without HBeAg negative conversion, or patients with HBeAg negative conversion and positive HBV-DNA and normal liver function, TCRVβ7 expression could not be detected.

Table 1 ALT, AST, TB and HBVDNA levels before and after treatment (mean ± SD).
nALT (U/L)AST (U/L)TB (μmol/L)HBVDNA (copy/mL)
Normal1027.80 ± 8.6519.07 ± 8.5012.55 ± 5.520
TreatmentPre-T40213.66 ± 10.30134.66 ± 9.8241.03 ± 4.36(1.52 ± 0.72) × 108.25
Post-T4037.01 ± 9.75b29.07 ± 8.97b20.55 ± 5.52b(4.25 ± 1.90) × 106.02 a
ControlPre-T25195.70 ± 11.11125.12 ± 9.2140.87 ± 6.78(1.32 ± 0.89) × 108.12
Post-T2536.01 ± 9.75b69.88 ± 8.97b30.55 ± 5.52b(6.95 ± 2.39) × 107.82
T lymphocyte subsets before and after treatment

The level of CD4+ cells was lower whereas the level of CD8+ cells was higher in the patients than in the normal group (P < 0.01), there was no significant difference between the levels of CD3+ cells of the patients and normal persons. After 6 mo of treatment, the level of CD4+ cells increased whereas the level of CD8+ cells decreased (P < 0.05) in the treated group. However, the level of CD4+ cells and CD8+ cells had no significant difference in the control group (P > 0.05, Table 2).

Table 2 T lymphocyte subsets before and after treatment (mean ± SD).
nCD3 (%)CD4 (%)CD8 (%)CD4/CD8
Normal1067.80 ± 8.6539.07 ± 8.5030.55 ± 5.521.62 ± 0.46
TreatmentPre-T4065.97 ± 8.4534.76 ± 4.82b34.08 ± 4.36b1.04 ± 0.32
Post-T4067.01 ± 9.7537.39 ± 8.97a32.35 ± 5.52a1.20 ± 0.30a
ControlPre-T2565.70 ± 9.1135.02 ± 5.21b34.87 ± 6.78b1.02 ± 0.29
Post-T2566.01 ± 9.7535.88 ± 8.9734.15 ± 5.521.09 ± 0.39
T lymphocyte subsets of responders and non-responders in treatment group before and after treatment

The level of CD3+, CD4+, CD8+ cells in the 2 groups had no significant difference before treatment (P > 0.05). The level of CD4+ cells increased whereas the level of CD8+ cells decreased in the responders’ group (P < 0.01). The level of CD4+ and CD8+ cells in the non-responders’ group had no significant difference after treatment (P > 0.05, Table 3).

Table 3 T lymphocyte subsets of responders and non-respond-ers in treatment group before and after treatment (mean ± SD).
nCD3 (%)CD4 (%)CD8 (%)
RespondersPre-T666.62 ± 8.8635.10 ± 4.76b34.02 ± 4.86b
Post-T666.80 ± 9.1138.85 ± 8.85a30.15 ± 5.82a
Non-respondersPre-T3465.86 ± 9.0834.62 ± 6.30b34.17 ± 6.56b
Post-T3466.09 ± 9.3535.72 ± 8.7033.85 ± 5.52
Normal1067.80 ± 8.6539.07 ± 8.5030.55 ± 5.52
DISCUSSION

Although the pathogenesis of chronic hepatitis B has not been fully studied, the importance of cellular immune in the occurrence of chronic HBV infection and elimination of HBV has received more and more attention[7]. CD3+, CD4+ and CD8+ are the major function subsets of T cells, many studies have discovered that CD3+, CD4+ of chronic hepatitis B with serum HBV positive are lower than those of chronic hepatitis B with serum HBV negative, and the higher the quantity of HBVDNA is, the lower the T cellular immune function is. Antiviral cellular immune response of CD4+ and CD8+ is the important mechanism of hepatocyte injury induced by HBV, the specific response of CD4+ and CD8+ to the virus antigen is closely related with the elimination of the virus. It is suggested that T cells could play a critical role in response to HBV infection, and their level and mutual relationship could be used to identify the cellular immune level and could serve as one of the valuable immunologic targets to forecast the change of patients' condition[8-12]. Some studies on chronic hepatitis B showed that T cell receptor function was the important cause of the obstacle to T cells, sequentially bringing about HBV escaping immune response, and finally resulting in standing HBV infection[2,3,13-16]. Therefore, it is very important to study the antiviral effect of T cells starting with immune identification.

TCR has been found to be the receptor of T lymphocyte surface recognising extra antigen and the major histocompatibility complex I (MHCI), as well as the specific sign of T cells[17-19]. The genes of the α and β chains which promote TCRαβ reset form ation of large amount of specific TCR to recognise the extra antigen when they meet antigen. TCR and CD3 would inosculate on the surface cells and form TCRCD3 compounds, the stimulating signals would be transferred to the inside of cells by CD3 molecules when antigens were recognised by TCR, activating T lymphocyte cells[20-26]. Some studies have indicated that the priority expression and employment of TCRVβ7 were related with the specific immune reaction of chronic hepatitis B[27-29]. Therefore, It is a meaningful pathway to eliminate HBV and decrease the occurrence of liver cancer by screening experimental recipes to activate T cells by improving T cell recognising function under the present circumstances of low cure ratio and high recurrence. We discovered that in the outbreak period of chronic hepatitis B, TCRVβ7 gene expression was low. The level of CD4+ cells was lower whereas the level of CD8+ cells was higher in patients than in the normal group (P < 0.01). The serum TCRVβ7 gene expressions of non-responders were low, the level of CD4+ cells of non-responders was lower in patients than in normal persons whereas the level of CD8+ cells of non-responders was higher in patients than in the normal persons. After treatment, the TCRVβ7 gene expression was high in patients with the conversion of HBV-DNA and HBeAg, and the liver function, the level of CD4+ and CD8+ cells resumed to normal. The levels of CD4+ and CD8+ cells in the treatment group were significantly different from those before treatment (P < 0.01). The results showed that TCRVβ7 participated in the elimination of HBV and cytotoxic function, and the occurrence of chronic hepatitis B was related to the low expression of TCRVβ7. The CTL could not be effectively activated to kill or injure HBV due to the obstacle of T cell receptor function, sequentially bringing about stable reproduction of HBV and resulting in chronic inflammation of hepatocytes. At the same time, we also discovered that TCRVβ7 expression of some patients in the palliating period was still low, indicating that recurrence might increase.

When HBeAg in chronic hepatitis B patients transforms to Anti-HBe, hepatocyte injury aggravates, which is considered to be mediated by CTL antiviral cellular immune response. The dynamic observation of 6 cases whose TCRVβ7 gene expressions were positive showed that the TCRVβ7 gene expression related with the HBeAg serum conversion, the decreased quantity of HBVDNA, and ALT levels experienced a period of acute exacerbation in the course of descending, suggesting that TCRVβ7 participated in the elimination of HBV and cytotoxic function. ALT fluctuation in patients with TCRVβ7 negative was small, and there was no obvious decrease in HBVDNA, or obvious HBeAg serumconversion, suggesting the cellular immune response of the patients was feeble. Thus TCRVβ7 might be an index to evaluate the cellular immune state of hepatitis B patients.

HBeAg is a good index that reflects the HBV replication. When HBeAg transforms to Anti-HBe, the reproduction of HBV will obviously weaken or cease, along with the relief of the state of illness. Among the 10 patients with HBeAg serum conversion, the quantity of HBVDNA in some patients did not alleviate or vanish after HBeAg serum conversion, and the state of illness fluctuated, which should be treated continually. HJD is a proved recipe for treating hepatitis, in which cold and warm drugs are used to eliminate evils and restore healthy energy. Previous researches indicated that HJD had the effect to protect the liver, as well as the function of antiviral and immune regulation[30-33]. We discovered that HJD could meliorate liver function, regulate TCRVβ7 gene expression, improve T cellular immune function of chronic hepatitis B in this study. The results suggest that the clinical effects of HJD on chronic hepatitis B, especially on the elimination of HBV, might relate with the improvement of TCR identifying function, and effectively activate CTL. However, HJD could not interrupt immune endurance of some patients, resulting in the failure of treatment, which needs further study to explore the cause and resolving methods.

References
1.  Wang YX, Ruan CP, Li L, Shi JH, Kong XT. Clinical significance of changes of perioperative T cell and expression of its activatedantigen in colorectal cancer patients. World J Gastroenterol. 1999;5:181-182.  [PubMed]  [DOI]
2.  Guo Y, Wu H, Li SY, Yan H. T cell receptor gene rearrangement of peripheral blood mononuclear cells from patients with chronic hepatitis B. Zhonghua Chuanranbing Zazhi. 2000;18:88-90.  [PubMed]  [DOI]
3.  Sugyo S, Yuh K, Nakamura K, Emi K, Shijo H, Iida T, Kimura N, Tamura K. An analysis of T cell antigen receptor variable beta genes during the clinical course of patients with chronic hepatitis B. J Gastroenterol Hepatol. 1999;14:333-338.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3]  [Cited by in RCA: 4]  [Article Influence: 0.1]  [Reference Citation Analysis (0)]
4.  Pardigon N, Cambouris C, Bercovici N, Lemaître F, Liblau R, Kourilsky P. Delayed and separate costimulation in vitro supports the evidence of a transient "excited" state of CD8+ T cells during activation. J Immunol. 2000;164:4493-4499.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3]  [Cited by in RCA: 4]  [Article Influence: 0.2]  [Reference Citation Analysis (0)]
5.  The infectious and parastil disease institute of Chinese medi-cal association. Diagnostic criteria of virus hepatitis. Zhonghua Chuanranbing Zazhi. 1995;13:242-247.  [PubMed]  [DOI]
6.  Yang LJ, Li YQ, Chen SH, Han SF, Chen ST, Zhang XL, Zhang T. [Comparison of the clonal expansion of TCR Vbeta T cells in patients with acute promyelocytic leukemia in vivo and in vitro]. Zhongguo Shiyan Xueyexue Zazhi. 2003;11:499-502.  [PubMed]  [DOI]
7.  Li L, Gu CH, Li X. [The significance of activation-induced cell death (AICD) in pathogenesis of hepatitis B]. Zhonghua Yixue Zazhi. 2003;83:1146-1149.  [PubMed]  [DOI]
8.  Wang KX, Peng JL, Wang XF, Tian Y, Wang J, Li CP. Detection of T lymphocyte subsets and mIL-2R on surface of PBMC in patients with hepatitis B. World J Gastroenterol. 2003;9:2017-2020.  [PubMed]  [DOI]
9.  Wang JP, Li XH, Zhu Y, Wang AL, Lian JQ, Jia ZS, Xie YM. Detection of serum sIL-2R, IL-6, IL-8, TNF- α and lympho-cytes subsets, mIL-2R in patients with chronic hepatitis B. Shijie Huaren Xiaohua Zazhi. 2000;8:763-766.  [PubMed]  [DOI]
10.  Crispe IN. Hepatic T cells and liver tolerance. Nat Rev Immunol. 2003;3:51-62.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 506]  [Cited by in RCA: 513]  [Article Influence: 22.3]  [Reference Citation Analysis (1)]
11.  Sing GK, Li D, Chen X, Macnaughton T, Lichanska AM, Butterworth L, Ladhams A, Cooksley G. A molecular comparison of T lymphocyte populations infiltrating the liver and circulating in the blood of patients with chronic hepatitis B: evidence for antigen-driven selection of a public complementarity-determining region 3 (CDR3) motif. Hepatology. 2001;33:1288-1298.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 24]  [Cited by in RCA: 27]  [Article Influence: 1.1]  [Reference Citation Analysis (0)]
12.  Zhang MX, Zhang XY, Jin SG, Dong HF, Chen JJ, Wang LT. The changes of peripheral blood CD 28T from patients with liver diseases. Shijie Huaren Xiaohua Zazhi. 2000;8:1432-1433.  [PubMed]  [DOI]
13.  Maru Y, Yokosuka O, Imazeki F, Saisho H, Omata M. Analysis of T cell receptor variable regions and complementarity determining region 3 of infiltrating T lymphocytes in the liver of patients with chronic type B hepatitis. Intervirology. 2003;46:277-288.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 6]  [Cited by in RCA: 7]  [Article Influence: 0.3]  [Reference Citation Analysis (0)]
14.  Huang S, Cao M, Luo L. [Hepatitis B virus antigen-induced specific TCR V beta gene subfamily amplifications and their diversity]. Zhonghua Shiyan He Linchuang Bingduxue Zazhi. 1998;12:318-321.  [PubMed]  [DOI]
15.  Soroosh P, Shokri F, Azizi M, Jeddi-Tehrani M. Analysis of T-cell receptor beta chain variable gene segment usage in healthy adult responders and nonresponders to recombinant hepatitis B vaccine. Scand J Immunol. 2003;57:423-431.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 15]  [Cited by in RCA: 16]  [Article Influence: 0.7]  [Reference Citation Analysis (0)]
16.  Suzuki T, Yamauchi K, Kuwata T, Hayashi N. Characterization of hepatitis B virus surface antigen-specific CD4+ T cells in hepatitis B vaccine non-responders. J Gastroenterol Hepatol. 2001;16:898-903.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 10]  [Cited by in RCA: 9]  [Article Influence: 0.4]  [Reference Citation Analysis (0)]
17.  Hodges E, Krishna MT, Pickard C, Smith JL. Diagnostic role of tests for T cell receptor (TCR) genes. J Clin Pathol. 2003;56:1-11.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 84]  [Cited by in RCA: 90]  [Article Influence: 3.9]  [Reference Citation Analysis (3)]
18.  Hughes MM, Yassai M, Sedy JR, Wehrly TD, Huang CY, Kanagawa O, Gorski J, Sleckman BP. T cell receptor CDR3 loop length repertoire is determined primarily by features of the V(D)J recombination reaction. Eur J Immunol. 2003;33:1568-1575.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 33]  [Cited by in RCA: 35]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
19.  Rezvany MR, Jeddi-Tehrani M, Wigzell H, Osterborg A, Mellstedt H. Leukemia-associated monoclonal and oligoclonal TCR-BV use in patients with B-cell chronic lymphocytic leukemia. Blood. 2003;101:1063-1070.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 58]  [Cited by in RCA: 57]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
20.  Jiang H, Curran S, Ruiz-Vazquez E, Liang B, Winchester R, Chess L. Regulatory CD8+ T cells fine-tune the myelin basic protein-reactive T cell receptor V beta repertoire during experimental autoimmune encephalomyelitis. Proc Natl Acad Sci USA. 2003;100:8378-8383.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 66]  [Cited by in RCA: 59]  [Article Influence: 2.6]  [Reference Citation Analysis (1)]
21.  Höhn H, Neukirch C, Freitag K, Necker A, Hitzler W, Seliger B, Maeurer MJ. Longitudinal analysis of the T-cell receptor (TCR)-VA and -VB repertoire in CD8+ T cells from individuals immunized with recombinant hepatitis B surface antigen. Clin Exp Immunol. 2002;129:309-317.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 24]  [Cited by in RCA: 23]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
22.  Vigan I, Jouvin-Marche E, Leroy V, Pernollet M, Tongiani-Dashan S, Borel E, Delachanal E, Colomb M, Zarski JP, Marche PN. T lymphocytes infiltrating the liver during chronic hepati-tis C infection express a broad range of T-cell receptor beta chain diversity. J Hepatol. 2003;38:651-659.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 11]  [Cited by in RCA: 10]  [Article Influence: 0.4]  [Reference Citation Analysis (0)]
23.  Turner SJ, Diaz G, Cross R, Doherty PC. Analysis of clonotype distribution and persistence for an influenza virus-specific CD8+ T cell response. Immunity. 2003;18:549-559.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 106]  [Cited by in RCA: 106]  [Article Influence: 4.6]  [Reference Citation Analysis (0)]
24.  Raaphorst FM, Schelonka RL, Rusnak J, Infante AJ, Teale JM. TCRBV CDR3 diversity of CD4+ and CD8+ T-lymphocytes in HIV-infected individuals. Hum Immunol. 2002;63:51-60.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 11]  [Cited by in RCA: 11]  [Article Influence: 0.5]  [Reference Citation Analysis (0)]
25.  Mitarnun W, Saechan V, Pradutkanchana J, Suwiwat S, Takao S, Ishida T. Epstein-Barr virus-associated peripheral T-cell lymphoma with gastrointestinal tract involvement. J Med Assoc Thai. 2003;86:816-828.  [PubMed]  [DOI]
26.  König R, Zhou W. Signal transduction in T helper cells: CD4 coreceptors exert complex regulatory effects on T cell activation and function. Curr Issues Mol Biol. 2004;6:1-15.  [PubMed]  [DOI]
27.  Abbott WG, Geursen A, Fraser JD, Marbrook J, Skinner MA, Tan PL. The influence of a maternal chronic hepatitis B virus infection on the repertoire of transcribed T-cell receptor beta chain variable region genes in human cord blood. Hepatology. 1995;22:1034-1039.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 3]  [Article Influence: 0.1]  [Reference Citation Analysis (0)]
28.  Chen X, Cooksley G, Sing G. Distinct patterns of T cell receptor distribution of peripheral blood CD8+ cells during different stages of chronic infection with hepatitis B virus. Hum Immunol. 1998;59:199-211.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 10]  [Cited by in RCA: 9]  [Article Influence: 0.3]  [Reference Citation Analysis (0)]
29.  Dou HY, Wu JC, Peng WL, Chang C, Chi WK, Chu YD, Hu CP. Analysis of T cell receptor Vbeta gene usage during the course of disease in patients with chronic hepatitis B. J Biomed Sci. 1998;5:428-434.  [PubMed]  [DOI]
30.  Zhang SJ, Chen ZX, Huang BJ. [Effect of hejie decoction on T-cell receptor V beta 7 gene expression in patients of chronic hepatitis B]. Zhongguo Zhongxiyi Jiehe Zazhi. 2002;22:499-501.  [PubMed]  [DOI]
31.  Zhang SJ, Chen ZX, Huang JB, Li JB. Clinical study on the He Jie Decoction in keeping HBeAg negative conversion states of chronic hepatitis B patients after HBeAg negative conversion. Zhonguo Zhongxiyi Jiehe Xiaohua Zazhi. 2001;9:92-93.  [PubMed]  [DOI]
32.  Zhang SJ, Chen ZX. Clinical study of He Jie Decoction on 37 chronic hepatitis B patients with HBeAg positive. Shiyong Zhongyi Zazhi. 1999;15:16-17.  [PubMed]  [DOI]
33.  Zhang SJ, Chen ZX, Huang JB, Li JB, Qin J, Huang BJ, Huang DX, Liu XQ. Clinical study of He Jie Decoction on IL-8, SIL-2R of chronic hepatitis B patients. Zhonghua Shiyong Zhongxiyi Zazhi. 2001;14:725-726.  [PubMed]  [DOI]
Footnotes

Edited by Wang XL and Xu FM

Write to the Help Desk