BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
Copyright: ©Author(s) 2026. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution-NonCommercial (CC BY-NC 4.0) license. No commercial re-use. See permissions. Published by Baishideng Publishing Group Inc.
World J Nephrol. Sep 25, 2026; 15(3): 119984
Published online Sep 25, 2026. doi: 10.5527/wjn.119984
Curcumin attenuates high glucose-induced apoptosis in renal tubular epithelial cells by enhancing the Nrf2/heme oxygenase-1 antioxidant pathway
Yu Li, Sai Xie, Yang Huang, Pei-Ling Bao, Department of Nephrology, Xiaogan Hospital Affiliated to Wuhan University of Science and Technology, Xiaogan 432000, Hubei Province, China
Lu-Lu Wang, Xiang-Zhi Yu, Department of Nephrology, Wuhan University of Science and Technology School of Medicine, Wuhan 430000, Hubei Province, China
Peng-Fei Li, Department of Cardiovascular Medicine, Xiaogan Hospital Affiliated to Wuhan University of Science and Technology, Xiaogan 432000, Hubei Province, China
ORCID number: Yu Li (0009-0000-9865-2020); Pei-Ling Bao (0009-0006-4320-8196).
Author contributions: Li Y, Wang LL, and Yu XZ contributed to data curation, investigation, validation, and writing of the original draft; Xie S contributed to formal analysis; Li PF and Huang Y contributed to data curation, methodology, and visualization; Bao PL contributed to conceptualization, project administration, resources, supervision, and manuscript review & editing; and all of the authors have read and approved the final manuscript.
Supported by Natural Science Foundation of Hubei Province, No. 2024AFB827.
Institutional animal care and use committee statement: This study was approved by the Ethics Committee of the Xiaogan Central Hospital (Ethical approval code: KY-20240710). All applicable international, national, and/or institutional guidelines for the care and use of animals were followed.
Conflict-of-interest statement: All authors declare that they have no conflict of interest to disclose.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Data sharing statement: No additional data are available.
Corresponding author: Pei-Ling Bao, FACC, Associate Chief Physician, Department of Nephrology, Xiaogan Hospital Affiliated to Wuhan University of Science and Technology, No. 6 Square Street, Xiaogan 432000, Hubei Province, China. bpltg2023@126.com
Received: February 12, 2026
Revised: March 20, 2026
Accepted: April 7, 2026
Published online: September 25, 2026
Processing time: 182 Days and 21.7 Hours

Abstract
BACKGROUND

Diabetic nephropathy (DN) is a major complication that arises from diabetes. Curcumin, a bioactive compound with antioxidant properties, has been shown to modulate multiple cellular pathways and thereby mitigate tissue damage.

AIM

To explore the influence of curcumin on high glucose-triggered apoptosis in renal tubular epithelial cells.

METHODS

Sprague-Dawley rats were divided into control, diabetic, and curcumin treatment groups (n = 10/group). Renal function markers (neutrophil gelatinase-associated lipocalin, KIM-1, and urinary albumin) were assessed, and renal tissues were analyzed using histopathology, TUNEL assays, and immunohistochemistry. Renal tubular epithelial cells were cultured under normal (5.5 mmol/L) or high glucose (30 mmol/L) conditions, with or without curcumin. Apoptosis, reactive oxygen species (ROS) levels, and Nrf2/heme oxygenase-1 (HO-1) signaling pathway markers were evaluated using flow cytometry, quantitative polymerase chain reaction, and immunohistochemistry.

RESULTS

Curcumin improved renal function markers and reduced renal tubular apoptosis in diabetic rats. In vitro, it suppressed high glucose-induced apoptosis and ROS production, while activating the Nrf2/HO-1 antioxidant pathway (upregulated Nrf2 and HO-1 expression, and downregulated Keap1) and modulating the Bcl-2/Bax apoptotic balance (downregulated Bax and upregulated Bcl-2), demonstrating sequential protection against oxidative stress followed by apoptosis inhibition.

CONCLUSION

Curcumin protects against high glucose–induced renal tubular epithelial apoptosis by enhancing Nrf2/HO-1 signaling to reduce oxidative stress and apoptosis, indicating its therapeutic potential for DN.

Key Words: Curcumin; Renal tubular epithelial cells; Apoptosis; Nrf2/heme oxygenase-1 signaling pathway; Oxidative stress

Core Tip: Diabetic nephropathy (DN) is the primary cause of end-stage renal disease. Oxidative stress-mediated renal tubular damage plays a significant role in the occurrence and progression of DN. Curcumin, a traditional Chinese medicinal component with antioxidant properties, may have therapeutic effects in the treatment of DN. Through in vivo and in vitro experiments, this study demonstrated that curcumin can inhibit renal tubular cell apoptosis in a high-sugar environment by enhancing the Nrf2/heme oxygenase-1 signaling pathway, thereby providing renal protection.



INTRODUCTION

Diabetic nephropathy (DN), a top cause of end-stage kidney disease, is associated with progressive renal tubular damage, oxidative stress, and fibrosis[1]. Increasing data suggests that tubular injury may precede glomerular injury. In diabetic rats, mitochondrial dynamics in proximal tubular epithelial cells change before proteinuria and histological kidney defects manifest[2]. Thus, increasing attention has focused on the role of proximal tubular damage in the pathogenesis of DN[3]. Hyperglycemia-induced reactive oxygen species (ROS) production plays a central role in mediating tubular epithelial cell apoptosis, a major contributor to renal fibrosis and functional decline in DN[4].

The Nrf2 pathway serves as a significant endogenous defense against oxidative stress, with Nrf2 normally sequestered in the cytoplasm by Keap1. Oxidative stress initiates the release of Nrf2, its entry into the nucleus, and the activation of ARE-driven genes such as heme oxygenase-1 (HO-1), thereby supporting ROS detoxification and safeguarding cells[5]. Activation of the Nrf2/HO-1 axis has been demonstrated to alleviate diabetic renal injury in both experimental and clinical settings[6,7].

Curcumin, a bioactive polyphenol extracted from Curcuma longa, has well-documented antioxidant and anti-inflammatory properties[8]. Previous studies have reported its beneficial effects in diabetes, including modulation of oxidative stress, glycemic control, lipid metabolism, and renal protection[9]. However, the precise mechanisms by which curcumin modulates renal tubular apoptosis in DN remain incompletely understood.

The present study aimed to determine if curcumin can safeguard renal tubular epithelial cells against oxidative injury and apoptosis caused by high glucose, via the activation of the Nrf2/HO-1 signaling pathway.

MATERIALS AND METHODS
Animals and reagents

Male Sprague-Dawley (SD) rats (6 weeks old, specific-pathogen-free grade) were purchased from Beijing Viton Lever Ltd. (Beijing, China). NRK-52E rat renal tubular epithelial cells were obtained from Wuhan Pronosai Life Sciences Co. (Wuhan, China). This study was approved by the Ethics Committee of Xiaogan Central Hospital (Approval code: KY-20240710), and all procedures followed relevant institutional and national animal welfare guidelines.

Streptozocin (STZ) was acquired from Sigma-Aldrich (St. Louis, MO, United States). Blood glucose meters and test strips were supplied by Aikang Biotechnology Ltd. (Fuzhou, China). The enzyme-linked immunosorbent assay kits for neutrophil gelatinase-associated lipocalin (NGAL), kidney injury molecule-1 (KIM-1), and microalbumin were obtained from Wuhan Huamei Biological Engineering Co., Ltd (Wuhan, China). Superoxide dismutase (SOD) assay kits were provided by Nanjing Jiancheng Technology Co., Ltd. (Nanjing, China).

Primary antibodies were sourced as follows: Nrf2 and HO-1 from Proteintech (Wuhan, China); Keap1 from Proteintech (Rosemont, IL, United States); and Bcl-2 and Bax from Shanghai Po Wan Biotechnology Co. (Shanghai, China).

Animal experimentation

Upon arrival, the SD rats were acclimatized for three days under standard laboratory conditions (temperature 22 ± 2 °C, humidity 50%-60%, 12 hours light/dark cycle) before experimental procedures, in accordance with the Guide for the Care and Use of Laboratory Animals (National Research Council, 2011). After acclimatization, body weights were measured, and animals showing extreme deviations were excluded. The remaining 30 rats were randomly assigned into three groups (n = 10 per group): Diabetic model group (STZ injection), curcumin treatment group (STZ injection + curcumin gavage), and control group (citrate buffer only).

Briefly, the diabetic model was established via a single intraperitoneal injection of STZ (150 mg/kg in citrate buffer). After 72 hours, fasting blood glucose (FBG) was measured. Rats with FBG ≥ 16.7 mmol/L were considered successfully modeled. The curcumin group received curcumin (100 mg/kg/day, by gavage) for 12 weeks post-induction. FBG and body weight were recorded weekly[10].

All animal procedures were approved by the Institutional Animal Care and Use Committee.

Sample collection

At the end of the experiment, rats were euthanized under anesthesia and both kidneys were immediately excised. After 6 hours of fasting, rats were anesthetized with 4% chloral hydrate. Urine samples were collected to test the concentrations of NGAL and KIM-1; 24-hour urine was collected in metabolic cages for analysis of microalbumin. Blood was collected from the medial canthus vein. The left kidney was fixed in 4% paraformaldehyde for histological analysis, immunohistochemistry, and TUNEL staining, while the right kidney was snap-frozen in liquid nitrogen and stored at -80 °C for RNA and protein analysis.

Histological and immunohistochemical staining

Kidneys were fixed in 10% formalin, paraffin-embedded, and sectioned (4 μm). Sections were deparaffinized and subjected to routine staining: Potassium dichromate-trichloroacetic acid treatment, Mayer’s hematoxylin, ponceau acid red, phosphomolybdic acid, and 2% Bright Green. Slides were dehydrated, cleared with xylene, and mounted. For each kidney section, ten non-overlapping microscopic fields were randomly selected at 200 × magnification to evaluate histological changes. The average value from the ten fields was used as the representative value for each sample.

For the TUNEL assay, sections were deparaffinized and treated with proteinase K, then labeled using terminal deoxynucleotidyl transferase mediated deoxyuridine triphosphate nick end labeling. Nuclei were counterstained using DAPI, and the slides were examined with a fluorescence microscope.

For the purpose of immunohistochemistry, antigen retrieval involved using citrate buffer at pH 6.0 under elevated temperature and pressure. The slides were treated with 3% H2O2 and 10% goat serum, and then incubated with primary antibodies overnight at 4 °C (Nrf2 1:500, HO-1 1:200, Bax 1:100, Bcl-2 1:200, Keap1 1:200). Secondary horse radish peroxidase -conjugated antibodies were applied for 1 hour at 37 °C, followed by diaminobenzidine visualization and hematoxylin counterstaining. Immunohistochemical staining intensity was quantified using ImageJ software. The integrated optical density of positively stained areas was measured and normalized to the total tissue area. The average value from ten randomly selected fields per section was calculated for statistical analysis. To ensure the objectivity and representativeness of the quantitative analysis, quantification was based on staining intensity in 10 random non-overlapping fields per tissue section at 200 × magnification. Due to the potential heterogeneity of protein expression in renal tissue, a single field of view may not fully represent the overall profile. Therefore, increasing the number of sampled fields to 10 can effectively reduce sampling errors caused by uneven tissue distribution, bring the data closer to a normal distribution, and provide a reliable foundation for subsequent statistical analysis.

Quantitative real-time polymerase chain reaction

Total RNA was extracted from kidney tissues using Triazole reagent. After ensuring the RNA’s purity and concentration, cDNA was synthesized with the Vazyme Kit. SYBR Green was used for quantitative polymerase chain reaction (qPCR), beginning with a 95 °C step for 30 seconds. The cycling parameters consisted of 40 cycles at 95 °C for 10 seconds and 60 °C for 30 seconds. Relative gene expression was calculated using the 2-ΔΔCt method, and the primer sequences can be found in Table 1.

Table 1 Primer sequences used for quantitative polymerase chain reaction.
Gene
Primer direction
Sequence (5′-3′)
Product size
GAPDHForwardACAGCAACAGGGTGGTGGAC253 bp
ReverseTTTGAGGGTGCAGCGAACTT
NRF2ForwardTGACTCTGACTCCGGCATTT188 bp
ReverseCCCAGAAGAATGTGTTGGC
HO-1ForwardGCATGTCCCAGGATTTGTCC192 bp
ReverseGGTTCTGCTTGTTTCGCTCT
BaxForwardAAGAAGCTGAGCGAGTGTCT153 bp
ReverseCCAGTTGAAGTTGCCGTCTG
Bcl-2ForwardGCCTTCTTTGAGTTCGGTGG221 bp
ReverseCTGAGCAGCGTCTTCAGAGA
Cell culture

NRK-52E cells were cultured in DMEM with 10% fetal bovine serum and 1% penicillin/streptomycin at 37 °C with 5% CO2. They were separated into a control group with 5.5 mmol/L glucose, a high glucose group with 30 mmol/L glucose, and a curcumin group with 30 mmol/L glucose and 5 μmol/L curcumin.

Apoptosis assay

Cells were collected with trypsin, washed with cold phosphate-buffered saline, and resuspended in Binding Buffer. Annexin V-FITC (5 μL) and PI were added, and the cells were incubated in the dark for 15 minutes. Apoptosis was quantified using flow cytometry.

ROS detection

After a 20-minute incubation at 37 °C with 10 μmol/L DCFH-DA, cells were washed and analyzed by flow cytometry (excitation: 488 nm; emission: 525 ± 20 nm) to assess the levels of intracellular ROS.

Statistical analysis

Data are expressed as the mean ± SD. Differences among multiple groups were analyzed using one-way ANOVA, and the t-test was used for comparisons between two groups. A P value less than 0.05 was considered statistically significant.

RESULTS
Protective effects of curcumin against STZ-induced alterations in body weight, fasting blood glucose, renal injury biomarkers, and kidney histopathology

STZ injection induced a diabetic state as typically characterized in body weight and increased FBG. Here, we also evaluated associated kidney injuries, as evidenced by increased urinary microalbumin and elevated renal injury biomarkers including KIM-1 and NGAL (Figure 1). As shown in Figure 1, the most common STZ-induced alterations involved body weight and FBG. According to Figure 1A, rats in the STZ group exhibited significant weight loss compared to the control group (P < 0.05), and the curcumin-treated group had a significantly higher body weight than the STZ group (P < 0.05). FBG levels were notably higher in the STZ group and continued to be elevated in the curcumin group relative to the control group (P < 0.05); however, curcumin significantly lowered FBG levels compared to untreated diabetic rats (P < 0.05), as shown in Figure 1B.

Figure 1
Figure 1 Effects of curcumin on general evaluations of diabetic injuries in rats. A: Changes in body weight over time. The body weight of the control group (black line) steadily increased throughout the observation period, reflecting normal growth. In contrast, the disease model group (gray line) displayed significantly reduced weight gain compared to the control group, which is indicative of disease-associated weight loss or stunting (P < 0.05). The curcumin-treated group (light gray line) showed improved weight gain relative to the model group (P < 0.05), suggesting that curcumin mitigates weight loss associated with the disease; B: Blood glucose levels over time. The control group maintained stable blood glucose levels, while the model group exhibited significantly elevated glucose levels (P < 0.01), indicating a disease-induced hyperglycemic state. Treatment with curcumin reduced glucose levels significantly compared to the model group (P < 0.05), although they remained higher than those of the control group, suggesting a partial therapeutic effect of curcumin on glucose regulation; C: Kidney injury molecule-1 (KIM-1) concentration (pg/mL). KIM-1, a biomarker of kidney injury, was significantly increased in the model group (aP < 0.05) compared to the control group, indicating renal damage. Curcumin treatment significantly reduced KIM-1 levels compared to the model group (aP < 0.05), implying a protective effect on kidney tissue; D: Neutrophil gelatinase-associated lipocalin (NGAL) concentration (ng/mL). NGAL, another biomarker of kidney injury, was significantly elevated in the model group (aP < 0.05) relative to the control group. Curcumin administration reduced NGAL levels compared to the model group (aP < 0.05), suggesting an ameliorative effect on kidney injury; E: Microalbuminuria levels (mg/day). Microalbuminuria, a marker of renal dysfunction, was substantially higher in the model group (aP < 0.05) than in the control group. Curcumin treatment significantly decreased microalbuminuria levels compared to the model group (aP < 0.05), indicating a protective or restorative effect on renal function; F: Renal histopathology change. Masson staining revealed tubular dilation and deformation, brush border loss, and interstitial inflammatory infiltration in both the streptozocin (STZ) and curcumin groups. However, compared to the STZ group, curcumin-treated rats showed milder tubular damage and reduced inflammatory infiltration. No significant interstitial fibrosis was observed in any group. KIM-1: Kidney injury molecule-1; NGAL: Neutrophil gelatinase-associated lipocalin; STZ: Streptozocin.

Urinary KIM-1 and NGAL levels, and microalbuminuria were compared among three groups (STZ vs control vs STZ + curcumin). KIM-1 significantly increased in STZ-treated rats compared to controls (P < 0.05), and curcumin intervention significantly decreased KIM-1 expression compared to the STZ group (P < 0.05), as shown in Figure 1C. NGAL levels in the urine were significantly elevated in the STZ group compared to controls (P < 0.05), and the curcumin group showed a reduction in NGAL levels compared to the STZ group (P < 0.05), as shown in Figure 1D. STZ-induced diabetic rats showed a marked increase in urinary microalbumin compared to controls (P < 0.05), and curcumin treatment significantly reduced microalbumin levels compared to the model group (P < 0.05), as shown in Figure 1E.

Masson’s trichrome staining revealed renal injury in STZ-treated renal sections compared to controls, whereas sections from the curcumin-treated group showed no significant interstitial fibrosis (Figure 1F). The control group showed normal tissue structure and cellular contours; in contrast, both the STZ and curcumin groups exhibited widespread tubular dilation and deformation, brush border loss, and interstitial inflammatory cell infiltration, although the extent of STZ-induced injury was notably less in the STZ + curcumin group, which had milder tubular injury and inflammatory infiltration (Figure 1F).

Figure 1 illustrates the physiological and biochemical effects of curcumin in a STZ-induced diabetic rat model. The STZ group displayed significant weight loss, hyperglycemia, and increased renal injury markers (KIM-1, NGAL, and microalbumin); curcumin treatment partially reversed these effects. These results suggest that curcumin exerts a protective role against diabetic kidney injury.

Protective effects of curcumin against renal tubular epithelial cell apoptosis under hyperglycemic conditions

The above pathophysiological analysis provided further insight into the molecular mechanism underlying DN injury and clarified the effects of curcumin targeting on the molecules. TUNEL staining results, depicted in Figure 2A and B, showed a significant increase in apoptotic renal tubular epithelial cells in the STZ group compared to the control group (P < 0.05). To calculate the apoptotic index, the percentage of TUNEL-positive cells was measured among all cells in 10 randomly selected non-overlapping fields at a magnification of 200 times. Compared to the STZ group, the curcumin-treated group had a significantly reduced apoptotic index (P < 0.05), which implies that curcumin mitigated apoptosis in renal tubular cells.

Figure 2
Figure 2 Curcumin reduces renal tubular epithelial cell apoptosis under hyperglycemic conditions. A and B: Representative images and quantitative analysis of TUNEL staining in rat kidney tissue. The apoptosis index was calculated as the ratio of TUNEL-positive cells to total cells in 10 non-overlapping fields per sample (200 × magnification). Compared with the control group, TUNEL-positive cells increased in the streptozocin (STZ) group (aP < 0.05); curcumin treatment significantly reduced TUNEL-positive cells (aP < 0.05); C and D: Flow cytometric analysis of apoptosis in renal tubular epithelial cells cultured under high-glucose conditions, showing significant differences between groups; E-G: Immunohistochemical staining of Bcl-2 and Bax in kidney tissues. Ten fields were selected per tissue section at 200 × magnification to determine relative expression levels. The results show increased expression of Bax and decreased Bcl-2 in the STZ group (aP < 0.05); curcumin further elevated Bcl-2 and reduced Bax expression (aP < 0.05); H and I: Quantitative polymerase chain reaction analysis of Bcl-2 and Bax mRNA expression in renal tubular epithelial cells. High glucose upregulated Bax and downregulated Bcl-2 mRNA (aP < 0.05); curcumin treatment further elevated Bcl-2 and suppressed Bax expression (aP < 0.05). STZ: Streptozocin.

Flow cytometry analysis further confirmed increased apoptosis in tubular epithelial cells under high-glucose conditions (Figure 2C and D). The high-glucose group showed a significantly elevated apoptosis rate compared to the control (P < 0.05). Treatment with curcumin markedly decreased the apoptosis rate relative to the high-glucose group (P < 0.05), suggesting a protective anti-apoptotic effect.

Immunohistochemical staining was quantitatively analyzed using ImageJ software, and the results showed decreased expression of the anti-apoptotic protein Bcl-2 and increased expression of the pro-apoptotic protein Bax in the STZ group compared to controls (Figure 2E-G; both P < 0.05). In the curcumin group, Bcl-2 expression significantly increased, while Bax expression significantly decreased compared to the STZ group (both P < 0.05).

In qPCR analysis (Figure 2H and I), hyperglycemia notably elevated Bax mRNA expression and reduced Bcl-2 mRNA expression in renal tubular epithelial cells in the STZ group compared to the control group (P < 0.05). The alterations were significantly reversed by curcumin treatment, with a notable increase in Bcl-2 and a decrease in Bax mRNA levels (P < 0.05 vs high-glucose group).

Curcumin enhances the Nrf2 pathway to alleviate oxidative stress in renal tubular epithelial cells under hyperglycemic conditions

To understand the antioxidative mechanism of curcumin in protecting renal tubular epithelial cells under high glucose conditions, several oxidative stress indicators and the Nrf2 signaling pathway were examined (Figure 3). First, flow cytometry revealed that compared to the control group, the high-glucose group showed a significant increase in intracellular ROS levels (P < 0.05). In contrast, curcumin treatment significantly reduced ROS levels (P < 0.05), indicating that curcumin effectively mitigates hyperglycemia-induced oxidative stress (Figure 3A and B). Second, immunohistochemistry of renal tissues showed increased Nrf2 and HO-1 expression and decreased Keap1 expression in the STZ group vs the control group (P < 0.05). Curcumin treatment further augmented Nrf2 and HO-1 levels while significantly suppressing Keap1 expression (P < 0.05), suggesting enhanced nuclear translocation of Nrf2 due to Keap1 downregulation (Figure 3C-F). Lastly, qPCR analysis confirmed these protein-level findings at the transcriptional level: Nrf2 and HO-1 mRNA expression was significantly upregulated in the high-glucose group compared to the control group (P < 0.05), while Keap1 mRNA was downregulated (P < 0.05). Curcumin treatment further increased Nrf2 and HO-1 mRNA levels (P < 0.05) and further suppressed Keap1 expression (P < 0.05), as shown in Figure 3G-I.

Figure 3
Figure 3 Curcumin attenuates oxidative stress in renal tubular epithelial cells through activation of the Nrf2 pathway. A and B: Flow cytometry analysis of reactive oxygen species (ROS) in renal tubular epithelial cells. Compared with the control group, ROS levels increased in the high-glucose group (aP < 0.05); curcumin treatment significantly reduced ROS (aP < 0.05); C-F: Immunohistochemistry of renal tissues showed increased expression of Nrf2 and heme oxygenase-1 (HO-1) and decreased Keap1 in the streptozocin group (aP < 0.05); curcumin further elevated Nrf2/HO-1 and reduced Keap1 expression (aP < 0.05); G-I: Quantitative polymerase chain reaction analysis of Nrf2, HO-1, and Keap1 mRNA in renal tubular epithelial cells. High glucose upregulated Nrf2 and HO-1 and downregulated Keap1 mRNA (aP < 0.05); curcumin treatment further enhanced Nrf2/HO-1 and suppressed Keap1 expression (aP < 0.05). STZ: Streptozocin.

Collectively, these data indicate that curcumin exerts renoprotective effects in diabetic conditions by activating the Nrf2/HO-1 antioxidant pathway and inhibiting Keap1, thereby reducing oxidative stress in renal tubular epithelial cells. These results imply that curcumin mitigates oxidative stress induced by hyperglycemia through the activation of the Nrf2/HO-1 pathway and the suppression of Keap1.

DISCUSSION

The renal tubulointerstitial compartment of the kidney accounts for 90% of the total mass of the kidney. It has been reported that proximal tubular lesions may occur earlier than glomerular disease[11]; therefore, tubular injury markers are more valuable than indicators of glomerular pathology for predicting DN progression[12,13]. With the breakthrough in SGLT2 inhibitor therapy, the significance of renal tubular lesions in DN has become increasingly prominent[14]. Reducing tubular epithelial cell apoptosis can reduce proteinuria, protect the kidney, and improve renal function[15,16]. Therefore, inhibition of tubular epithelial cell apoptosis can be considered a potential therapeutic approach for DN. Several studies have shown that tubular injury and apoptosis occur earlier than overt interstitial fibrosis in DN. Fibrotic deposition typically develops after longer durations of hyperglycemia (16-24 weeks) in STZ models[17]. The experimental duration of this study was 12 weeks, during which clear evidence of renal tubular apoptosis and oxidative stress was observed, with no significant tubulointerstitial fibrosis detected by Masson staining (Figure 1F).

Apoptosis of renal tubular epithelial cells in diabetic patients is closely associated with oxidative stress[18], because there is excessive ROS production in the cytoplasm or mitochondria of renal tubular epithelial cells, which is caused by prolonged hyperglycemia and hyperlipidemia. ROS disrupts cellular redox homeostasis, leading to dysregulation of the expression of multiple genes associated with DN development and progression[19]. Furthermore, diabetes-induced ROS can regulate or activate pro-apoptotic mediators[20]. In addition, certain apoptotic programs can be activated directly by ROS, such as ischemia and hypoxia-mediated apoptosis in the renal tissue of patients with DN. This is caused by oxidative stress, suggesting that anti-oxidative stress therapy might be effective for treating DN, which has been validated in many clinical studies.

Growing evidence supports the point of view that curcumin is a potential therapeutic agent because of its antioxidant and anti-inflammatory effects, with fewer side effects[21]. Numerous studies have suggested the significant efficacy of curcumin in the treatment and prevention of diabetes. A systematic review by Marton et al[22] revealed the inhibitory effects of curcumin on diabetic pathological changes in the following aspects: Processes of oxidative stress and inflammation; alternation of FBG, glycated hemoglobin, and body mass index; and changes in triglycerides, total cholesterol, low-density lipoprotein, high-density lipoprotein, serum C-reactive protein, and plasma malondialdehyde (MDA). On the other hand, curcumin has neuroprotective effects on lesions in the hippocampus of STZ-induced diabetic rats by significantly increasing the activities of SOD, catalase (CAT), glutathione peroxidase, and glutathione[23]. After curcumin treatment, multiple parameters in STZ-induced diabetic rats were improved, including increased activities of antioxidant enzymes (such as SOD, CAT, and paraoxonase-1 in the kidney and liver), and a reduced level of advanced glycosylation end products[24]. A similar study also found that oral administration of curcumin (500 mg, daily for 15-30 days) in patients with type 2 DN can decrease microalbumin levels in the urine, upregulate Nrf2 expression in blood cells, and reduce plasma MDA levels, thereby delaying DN progression[25]. Like the reports in the literature, our study also found that curcumin attenuated microalbuminuria and reduced pathological kidney damage in rats with DN. Moreover, the findings of this study indicated that curcumin decreased ROS production, raised SOD activity, and upregulated Nrf2 and HO-1 expression in renal tubular epithelial cells in a high glucose environment, highlighting its inhibitory effect on oxidative stress.

Nrf2 is a leucine zipper transcription factor that is mainly located in organs like the liver, kidney, and lung, which are involved in metabolic detoxification. It is also considered a key factor in the regulation of cellular resistance to xenobiotics. In the cytoplasm, Nrf2 usually binds to Keap1 under normal conditions. During oxidative stress, Nrf2 disengages from Keap1 and is transported to the nucleus, where it can activate the transcription of genes with AREs, leading to the reduction of ROS to maintain cellular redox homeostasis[26]. Interestingly, we observed a moderate upregulation of both the mRNA and protein levels of Nrf2 and HO-1 in renal tubular epithelial cells treated with high glucose alone (Figure 3). This observation may reflect an adaptive antioxidant response to hyperglycemia-induced oxidative stress. Previous studies have reported that Nrf2 activation can occur as a compensatory mechanism during metabolic stress; however, this response is often insufficient to counteract sustained ROS production and cellular injury[27]. Curcumin treatment further enhanced Nrf2/HO-1 expression while reducing ROS accumulation and apoptosis, suggesting that curcumin may amplify the endogenous antioxidant defense system that is activated during hyperglycemia.

Nrf2 directly activates HO-1 transcription, thereby enhancing anti-inflammatory and antioxidant effects by producing substances such as carbon monoxide and bilirubin. Researchers have found that a variety of natural and synthetic Nrf2 activators can effectively improve the phenotypes of DN[28]. Umbelliferon, a natural product extracted from various plants of the family Umbelliferon, can inhibit iron death by activating the Nrf2/HO-1 pathway, thereby delaying DN progression[29]. Similarly, the ethanolic extract of Rhizome Chuanxiong significantly improved urine output, which is the renal morphological damage that occurred in STZ-induced DN mice with glomerulosclerosis and fibrosis[30]. The vitamin D receptor activator paricalcitol can effectively alleviate ferroptosis and renal injury in diabetic renal tubular epithelial cells by enhancing the Nrf2/HO-1 signaling pathway[31]. Knockout of the Nrf2 gene in the STZ-induced diabetic mouse model can stimulate more ROS production, leading to more extensive renal tissue damage compared to mice with wild-type Nrf2. By contrast, treatment with an Nrf2 inducer can significantly improve renal function and attenuate the common signs of metabolic abnormalities and renal tubular pathology in diabetic mice with wild-type Nrf2 rather than in Nrf2 knockout mice[32]. In addition, both baicalin and fork head box 1 can inhibit apoptosis in renal tubular epithelial cells by activating the Nrf2 signaling pathway[33,34]. These findings suggest that the induction of Nrf2 activation might be a potential strategy for preventing and treating DN. Actually, our study found that the expression of Nrf2 and HO-1 was upregulated, but Keap1 expression was downregulated in renal tubular epithelial cells after curcumin treatment. Meanwhile, apoptosis in diabetic rats was also reduced by curcumin treatment. We proposed, based on these results, that curcumin shields renal tubular epithelial cells by augmenting Nrf2/HO-1 signaling, contributing to reduced oxidative stress and apoptosis. The primary focus of our research was to study hyperglycemia-induced oxidative stress and tubular injury, so we selected the single high-dose STZ model, as it primarily mimics type 1 diabetes; however, future studies can use type 2 diabetic models (e.g., db/db or HFD-STZ models) to further validate the translational relevance.

CONCLUSION

In conclusion, curcumin may exert its reno-protective effects by inhibiting high glucose-induced apoptosis in renal tubular epithelial cells.

References
1.  Wang Y, Jin M, Cheng CK, Li Q. Tubular injury in diabetic kidney disease: molecular mechanisms and potential therapeutic perspectives. Front Endocrinol (Lausanne). 2023;14:1238927.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 60]  [Cited by in RCA: 78]  [Article Influence: 26.0]  [Reference Citation Analysis (1)]
2.  Coughlan MT, Nguyen TV, Penfold SA, Higgins GC, Thallas-Bonke V, Tan SM, Van Bergen NJ, Sourris KC, Harcourt BE, Thorburn DR, Trounce IA, Cooper ME, Forbes JM. Mapping time-course mitochondrial adaptations in the kidney in experimental diabetes. Clin Sci (Lond). 2016;130:711-720.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 152]  [Cited by in RCA: 141]  [Article Influence: 14.1]  [Reference Citation Analysis (0)]
3.  Palau V, Nugraha B, Benito D, Pascual J, Emmert MY, Hoerstrup SP, Riera M, Soler MJ. Both Specific Endothelial and Proximal Tubular Adam17 Deletion Protect against Diabetic Nephropathy. Int J Mol Sci. 2021;22:5520.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 16]  [Cited by in RCA: 16]  [Article Influence: 3.2]  [Reference Citation Analysis (0)]
4.  Jin Q, Liu T, Qiao Y, Liu D, Yang L, Mao H, Ma F, Wang Y, Peng L, Zhan Y. Oxidative stress and inflammation in diabetic nephropathy: role of polyphenols. Front Immunol. 2023;14:1185317.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 336]  [Cited by in RCA: 312]  [Article Influence: 104.0]  [Reference Citation Analysis (4)]
5.  Cui W, Min X, Xu X, Du B, Luo P. Role of Nuclear Factor Erythroid 2-Related Factor 2 in Diabetic Nephropathy. J Diabetes Res. 2017;2017:3797802.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 51]  [Cited by in RCA: 48]  [Article Influence: 5.3]  [Reference Citation Analysis (0)]
6.  Yuan X, Tang W, Lin C, He H, Li L. Chrysophanol ameliorates oxidative stress and pyroptosis in mice with diabetic nephropathy through the Kelch-like ECH-associated protein 1/nuclear factor erythroid 2-related factor 2 signaling pathway. Acta Biochim Pol. 2023;70:891-897.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 4]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
7.  Yang Y, Chen G, Cheng X, Teng Z, Cai X, Yang J, Sun X, Lu W, Wang X, Yao Y, Hu C, Cao P. Therapeutic potential of digitoflavone on diabetic nephropathy: nuclear factor erythroid 2-related factor 2-dependent anti-oxidant and anti-inflammatory effect. Sci Rep. 2015;5:12377.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 26]  [Cited by in RCA: 25]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
8.  Priyadarsini KI. The chemistry of curcumin: from extraction to therapeutic agent. Molecules. 2014;19:20091-20112.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1238]  [Cited by in RCA: 881]  [Article Influence: 73.4]  [Reference Citation Analysis (0)]
9.  Xue M, Tian Y, Zhang H, Dai S, Wu Y, Jin J, Chen J. Curcumin nanocrystals ameliorate ferroptosis of diabetic nephropathy through glutathione peroxidase 4. Front Pharmacol. 2024;15:1508312.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 7]  [Cited by in RCA: 9]  [Article Influence: 9.0]  [Reference Citation Analysis (0)]
10.  Motaharinia J, Panahi Y, Barreto GE, Beiraghdar F, Sahebkar A. Efficacy of curcumin on prevention of drug-induced nephrotoxicity: A review of animal studies. Biofactors. 2019;45:690-702.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 10]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
11.  Jiang S, Jiao Y, Zou G, Gao H, Zhuo L, Li W. Activation of Complement Pathways in Kidney Tissue May Mediate Tubulointerstitial Injury in Diabetic Nephropathy. Front Med (Lausanne). 2022;9:845679.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 10]  [Cited by in RCA: 10]  [Article Influence: 2.5]  [Reference Citation Analysis (1)]
12.  Villalvazo P, Villavicencio C, Gonzalez de Rivera M, Fernandez-Fernandez B, Ortiz A. Systems Biology and Novel Biomarkers for the Early Detection of Diabetic Kidney Disease. Nephron. 2025;149:29-35.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 3]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
13.  Lv Y, Ye C, Li Z, Ye J, Cao H, Zhang C, Jiang H, Wang Y. Tubular Injury in Diabetic Kidney Disease: Early Diagnosis and Intervention Strategies. Diabetes Metab Res Rev. 2025;41:e70098.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 9]  [Cited by in RCA: 14]  [Article Influence: 14.0]  [Reference Citation Analysis (0)]
14.  DeFronzo RA, Reeves WB, Awad AS. Pathophysiology of diabetic kidney disease: impact of SGLT2 inhibitors. Nat Rev Nephrol. 2021;17:319-334.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 494]  [Cited by in RCA: 452]  [Article Influence: 90.4]  [Reference Citation Analysis (5)]
15.  Yu H, Tang H, Wang M, Xu Q, Yu J, Ge H, Qiang L, Tang W, Gu HF. Effects of total flavones of Abelmoschus manihot (L.) on the treatment of diabetic nephropathy via the activation of solute carriers in renal tubular epithelial cells. Biomed Pharmacother. 2023;169:115899.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 18]  [Cited by in RCA: 19]  [Article Influence: 6.3]  [Reference Citation Analysis (0)]
16.  Guo Y, Xie X, Zhao Y, Zhou M, Yang Y, Zhang X. Calcitriol attenuates renal tubular epithelial cells apoptosis via inhibiting p38MAPK signaling in diabetic nephropathy. Acta Diabetol. 2020;57:1327-1335.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 19]  [Cited by in RCA: 18]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
17.  Liu X, Zhang C, Fu Y, Xie L, Kong Y, Yang X. Inflammation, Apoptosis, and Fibrosis in Diabetic Nephropathy: Molecular Crosstalk in Proximal Tubular Epithelial Cells and Therapeutic Implications. Curr Issues Mol Biol. 2025;47:885.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 7]  [Cited by in RCA: 17]  [Article Influence: 17.0]  [Reference Citation Analysis (0)]
18.  Habib SL. Diabetes and renal tubular cell apoptosis. World J Diabetes. 2013;4:27-30.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in CrossRef: 80]  [Cited by in RCA: 80]  [Article Influence: 6.2]  [Reference Citation Analysis (0)]
19.  Han Y, Xu X, Tang C, Gao P, Chen X, Xiong X, Yang M, Yang S, Zhu X, Yuan S, Liu F, Xiao L, Kanwar YS, Sun L. Reactive oxygen species promote tubular injury in diabetic nephropathy: The role of the mitochondrial ros-txnip-nlrp3 biological axis. Redox Biol. 2018;16:32-46.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 407]  [Cited by in RCA: 391]  [Article Influence: 48.9]  [Reference Citation Analysis (0)]
20.  Hong L, Li M, Fan Y. Oxidative stress and programmed cell death in diabetic wounds: A comprehensive review. Sci Prog. 2025;108:368504251370676.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2]  [Cited by in RCA: 7]  [Article Influence: 7.0]  [Reference Citation Analysis (0)]
21.  Surma S, Sahebkar A, Urbański J, Penson PE, Banach M. Curcumin - The Nutraceutical With Pleiotropic Effects? Front Nutr. 2022;9:865497.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 21]  [Cited by in RCA: 18]  [Article Influence: 4.5]  [Reference Citation Analysis (0)]
22.  Marton LT, Pescinini-E-Salzedas LM, Camargo MEC, Barbalho SM, Haber JFDS, Sinatora RV, Detregiachi CRP, Girio RJS, Buchaim DV, Cincotto Dos Santos Bueno P. The Effects of Curcumin on Diabetes Mellitus: A Systematic Review. Front Endocrinol (Lausanne). 2021;12:669448.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 168]  [Cited by in RCA: 128]  [Article Influence: 25.6]  [Reference Citation Analysis (2)]
23.  Zhu X, Xu X, Du C, Su Y, Yin L, Tan X, Liu H, Wang Y, Xu L, Xu X. An examination of the protective effects and molecular mechanisms of curcumin, a polyphenol curcuminoid in diabetic nephropathy. Biomed Pharmacother. 2022;153:113438.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 33]  [Cited by in RCA: 28]  [Article Influence: 7.0]  [Reference Citation Analysis (0)]
24.  Mohammad CA, Ali KM, Sha AM, Gul SS. Antioxidant Effects of Curcumin Gel in Experimental Induced Diabetes and Periodontitis in Rats. Biomed Res Int. 2022;2022:7278064.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 12]  [Cited by in RCA: 9]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
25.  Yang H, Xu W, Zhou Z, Liu J, Li X, Chen L, Weng J, Yu Z. Curcumin attenuates urinary excretion of albumin in type II diabetic patients with enhancing nuclear factor erythroid-derived 2-like 2 (Nrf2) system and repressing inflammatory signaling efficacies. Exp Clin Endocrinol Diabetes. 2015;123:360-367.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 95]  [Cited by in RCA: 83]  [Article Influence: 7.5]  [Reference Citation Analysis (0)]
26.  Cheng D, Gao L, Su S, Sargsyan D, Wu R, Raskin I, Kong AN. Moringa Isothiocyanate Activates Nrf2: Potential Role in Diabetic Nephropathy. AAPS J. 2019;21:31.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 53]  [Cited by in RCA: 47]  [Article Influence: 6.7]  [Reference Citation Analysis (0)]
27.  Lee E, Ahn JH, Kang BC, Lee HS. Nrf2-Dependent Adaptation to Oxidative Stress Protects Against Progression of Diabetic Nephropathy. Antioxid Redox Signal. 2025;42:751-766.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 3]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
28.  Ebrahimi R, Mohammadpour A, Medoro A, Davinelli S, Saso L, Miroliaei M. Exploring the links between polyphenols, Nrf2, and diabetes: A review. Biomed Pharmacother. 2025;186:118020.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 15]  [Cited by in RCA: 27]  [Article Influence: 27.0]  [Reference Citation Analysis (0)]
29.  Jin T, Chen C. Umbelliferone delays the progression of diabetic nephropathy by inhibiting ferroptosis through activation of the Nrf-2/HO-1 pathway. Food Chem Toxicol. 2022;163:112892.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 98]  [Cited by in RCA: 88]  [Article Influence: 22.0]  [Reference Citation Analysis (3)]
30.  Yan Y, Shi H, Li Y, Wan X, Li J, Wang L. Mechanism of Rhizoma Chuanxiong for the treatment of diabetic kidney disease based on network pharmacology. Ren Fail. 2025;47:2524528.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 2]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
31.  Wang H, Yu X, Liu D, Qiao Y, Huo J, Pan S, Zhou L, Wang R, Feng Q, Liu Z. VDR Activation Attenuates Renal Tubular Epithelial Cell Ferroptosis by Regulating Nrf2/HO-1 Signaling Pathway in Diabetic Nephropathy. Adv Sci (Weinh). 2024;11:e2305563.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 80]  [Cited by in RCA: 104]  [Article Influence: 52.0]  [Reference Citation Analysis (1)]
32.  Zhang B, Zhang X, Zhang C, Shen Q, Sun G, Sun X. Notoginsenoside R1 Protects db/db Mice against Diabetic Nephropathy via Upregulation of Nrf2-Mediated HO-1 Expression. Molecules. 2019;24:247.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 74]  [Cited by in RCA: 81]  [Article Influence: 11.6]  [Reference Citation Analysis (1)]
33.  Singh J, Chaudhari BP, Kakkar P. Baicalin and chrysin mixture imparts cyto-protection against methylglyoxal induced cytotoxicity and diabetic tubular injury by modulating RAGE, oxidative stress and inflammation. Environ Toxicol Pharmacol. 2017;50:67-75.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 36]  [Cited by in RCA: 35]  [Article Influence: 3.9]  [Reference Citation Analysis (0)]
34.  Darenskaya M, Kolesnikov S, Semenova N, Kolesnikova L. Diabetic Nephropathy: Significance of Determining Oxidative Stress and Opportunities for Antioxidant Therapies. Int J Mol Sci. 2023;24:12378.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 76]  [Cited by in RCA: 64]  [Article Influence: 21.3]  [Reference Citation Analysis (0)]
Footnotes

Peer review: Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Urology and nephrology

Country of origin: China

Peer-review report’s classification

Scientific quality: Grade C, Grade D

Novelty: Grade D, Grade D

Creativity or innovation: Grade D, Grade D

Scientific significance: Grade C, Grade D

P-Reviewer: Ebraheim LLM, PhD, Post Doctoral Researcher, Professor, Egypt; Feyissa GD, Assistant Professor, Ethiopia S-Editor: Liu JH L-Editor: Wang TQ P-Editor: Zhao YQ

Write to the Help Desk