Published online Nov 27, 2013. doi: 10.5496/wjmg.v3.i4.41
Revised: August 29, 2013
Accepted: September 3, 2013
Published online: November 27, 2013
Processing time: 187 Days and 19.7 Hours
AIM: To investigate whether hypoxia induces dedifferentiation of non-small cell lung cancer (NSCLC) cells and whether a hypoxia-inducible factor (HIF) inhibitor is able to suppress the process.
METHODS: Human lung adenocarcinoma A549 cells and squamous carcinoma QG56 cells were cultured under normoxic (21% O2) or hypoxic (4% or 1% O2) conditions. The expression of the following genes were examined by reverse transcription-polymerase chain reaction, Western blotting and/or immunofluorescence: HIF-1α and HIF-2α subunits; differentiation marker genes, namely surfactant protein C (SP-C) (type II alveolar cell marker), CC10 (type I alveolar cell marker) and aquaporin 5 (AQP5) (Clara cell marker); and stem cell-associated genes, namely CD133, OCT4, and Musashi-1 (MSI1). The tumor sphere-forming ability of the cells was evaluated by culturing them in serum-free growth factor-rich medium containing epidermal growth factor (EGF) and fibroblast growth factor (FGF). CD133 expression in hypoxic regions in A549 tumors was examined by double-immunostaining of tissue cryosections with an anti-2-nitroimidazole EF5 antibody and an anti-CD133 antibody. The metastatic ability of A549 cells was examined macroscopically and histologically after injecting them into the tail vein of immunocompromised mice.
RESULTS: A549 cells primarily expressed SP-C, and QG56 cells expressed CC10 and AQP5. Exposure of A549 cells to hypoxia resulted in a marked down-regulation of SP-C and upregulation of CD133, OCT4, and MSI1 in a time-dependent manner. Moreover, hypoxia mimetics, namely desferrioxamine and cobalt chloride, elicited similar effects. Ectopic expression of the constitutively active HIF-1α subunit also caused the downregulation of SP-C and upregulation of CD133 and MSI1 but not OCT4, which is a direct target of HIF-2. Hypoxia enhanced the sphere-forming activity of A549 cells in serum-free medium containing EGF and FGF. Similarly, hypoxia downregulated the expression of CC10 and AQP5 genes and upregulated CD133, OCT4, and MSI1 genes in QG56 cells. TX-402 (3-amino-2-quinoxalinecarbonitrile 1, 4-dioxide), which is a small molecule inhibitor of the expression of HIF-1α and HIF-2α subunits under hypoxic conditions, inhibited the upregulation of SP-C and hypoxia-induced down-regulation of CD133, OCT4, and MSI1. Notably, TX-402 significantly suppressed the hypoxia-enhanced lung-colonizing ability of A549 cells.
CONCLUSION: Hypoxia induces the de-differentiation of NSCLC cells into cancer stem cell-like cells, and HIF inhibitors are promising agents to prevent this process.
Core tip: Hypoxia induces the de-differentiation of human non-small cell lung cancer cells into cancer stem cell-like cells, and TX-402, a small-molecule inhibitor of hypoxia-inducible factor (HIF)-1α and HIF-2α expression, suppresses this hypoxia-induced process and, importantly, the metastatic ability of the cells.
- Citation: Akimoto M, Nagasawa H, Hori H, Uto Y, Honma Y, Takenaga K. An inhibitor of HIF-α subunit expression suppresses hypoxia-induced dedifferentiation of human NSCLC into cancer stem cell-like cells. World J Med Genet 2013; 3(4): 41-54
- URL: https://www.wjgnet.com/2220-3184/full/v3/i4/41.htm
- DOI: https://dx.doi.org/10.5496/wjmg.v3.i4.41
Core tip: Hypoxia induces the de-differentiation of human non-small cell lung cancer cells into cancer stem cell-like cells, and TX-402, a small-molecule inhibitor of hypoxia-inducible factor (HIF)-1α and HIF-2α expression, suppresses this hypoxia-induced process and, importantly, the metastatic ability of the cells.
In most solid tumors, hypoxic regions are generated because of a shortage in oxygen supply[1-3]. Hypoxia influences many aspects of cancer cell biology, including neoangiogenesis, energy metabolism, cell survival, radiosensitivity, chemosensitivity, differentiation and invasion/metastasis[1-4]. Thus, hypoxia correlates with poor patient outcomes[5]. Recent preclinical studies have also demonstrated that anti-angiogenic therapies generate intratumoral hypoxia and, thereby, elicit increases in invasiveness and metastasis[6-8].
Hypoxia activates the expression of hundreds of genes in each cell[1-3]. Many of these genes are regulated by hypoxia-inducible factors (HIFs) such as HIF-1 and HIF-2. Under normoxic conditions, the α subunit of HIF-1 (HIF-1α) is hydroxylated at the proline-402 and proline-564 residues by specific Fe2+, 2-oxoglutarate, and O2-dependent prolyl hydroxylases. The subunit is then recognized and ubiquitinated by the von Hippel-Lindau tumor suppressor protein complex, leading to degradation via the ubiquitin-proteasome pathway. Under hypoxic conditions, the HIF-α subunit stabilizes and dimerizes with the HIF-β subunit. In the nucleus, HIF-1 binds to the hypoxia response element (HRE) of hypoxia-inducible genes and transactivates their transcription[9]. Chelating or substituting Fe2+ with desferrioxamine (DFO) or CoCl2, respectively, increases the levels of HIF-1α and HIF-2α[1-3]. Although there are many similarities between HIF-1 and HIF-2, each has common as well as different HRE target genes.
Hypoxia influences stem cell self-renewal and multipotency[10]. HIF-2 but not HIF-1 is reported to regulate the expression of OCT4, a POU transcription factor that is associated with the self-renewal and pluripotency of stem cells[11]. Hypoxia is also known to induce the dedifferentiation of neuroblastoma and breast cancer cells[12]. These data indicate that hypoxia is involved not only in the dedifferentiation of tumor cells but also in the maintenance of cancer stem cells (CSCs) with high metastatic potential.
The lung is composed of multiple types of cells such as Clara, alveolar type I (AT1), alveolar type II (AT2), and pulmonary neuroendocrine cells[13]. Each cell type expresses lineage-specific differentiation marker gene products. For example, CC10 (also known as CCA or CCSP), aquaporin 5 (AQP5), and pro-surfactant protein C (SP-C) are the specific markers for Clara, AT1 and AT2 cells, respectively[14-16]. A rare population of progenitor cells, referred to as the bronchoalveolar stem cells (BASCs), exists in the bronchoalveolar duct junction of mouse normal lung[17]. Lung adenocarcinoma is thought to originate from BASCs, which frequently co-express SP-C and CC10[17-19]. Several recent studies have demonstrated the existence of a rare population of CD133-positive undifferentiated cells in small cell and non-small cell lung cancer (NSCLC) that exhibit CSC characteristics[20-23]. The metabolic enzyme, glycine decarboxylase (GLDC), has also been reported to be a key characteristic of CSCs in NSCLC[24]. In contrast, it is largely unknown how tumor hypoxia affects the differentiation- and stem cell-related gene expression in NSCLC cells.
Many small molecule HIF-1 inhibitors have been identified or developed to inhibit angiogenesis and suppress the growth of a variety of tumor cells[25]. However, the influence of such HIF-1 inhibitors on the hypoxia-induced dedifferentiation of human lung cancer cells to CSC-like cells remains unknown. Assuming that HIF-1α and HIF-2α are necessary for inducing and maintaining CSC characteristics under hypoxic conditions, inhibitors of their expression or activity would have a profound inhibitory effect on such hypoxia-induced processes.
TX-402 is a member of a group of hypoxia-selective cytotoxins, which includes tirapazamine (TPZ), that are activated by bioreduction to selectively exhibit cytotoxicity under severe hypoxia (< 1% O2). TX-402 and its analogs inhibit HIF-1α protein synthesis under hypoxia without affecting the HIF-1α steady-state mRNA level and the protein degradation rate, and they also reduce the hypoxia-inducible expression of vascular endothelial growth factor (VEGF) and angiogenesis[26-28]. Although the mechanism by which TX-402 inhibits HIF-1α protein synthesis is still unclear, TPZ and other hypoxic cytotoxins have recently been reported to inhibit HIF-1α translation through the phosphorylation of translation initiation factor 2α (eIF2α) and/or the dephosphorylation of mTOR and 4E-BP1[29,30]. Of interest, TPZ has been shown to selectively deplete primitive hematopoietic stem cell subsets in bone marrow[31]. Therefore, this class of bioreductive agents could have a major impact on cancer therapy if developed appropriately. Against this background, in the present study, we primarily employed human lung adenocarcinoma A549 cells and investigated the effects of hypoxia and TX-402 on differentiation- and stem cell-related gene expression and metastasis.
Human lung adenocarcinoma cells (A549, PC3, PC9, and PC14), squamous cell carcinoma cells (PC1, PC10, and QG56), bronchoalveolar carcinoma cells (H358), and small cell carcinoma cells (PC6 and QG90) were cultured in Dulbecco’s modified Eagle’s medium containing 10% heat-inactivated fetal bovine serum supplemented with penicillin (100 units/mL) and streptomycin (100 μg/mL) in a humidified atmosphere with 21% O2/5% CO2 (normoxia) or 1% O2/5% CO2 (hypoxia) unless otherwise stated. In some experiments, the cells were cultured in 4% O2/5% CO2. The cells were provided by the Chiba Cancer Center Research Institute[32].
TX-402 (3-amino-2-quinoxalinecarbonitrile 1,4-dioxide) was synthesized according to a previous report[33]. DFO and cobalt chloride were obtained from Sigma-Aldrich (St. Louis, MO, United States). EF5 was provided by the National Cancer Institute (CTEP).
Mouse monoclonal anti-β-actin antibody was obtained from Sigma-Aldrich. Mouse monoclonal anti-HIF-1α and rabbit polyclonal anti-HIF-2α antibodies were purchased from Novus Biologicals (Littleton, CO, United States). The rabbit polyclonal anti-CD133 antibody, goat polyclonal anti-OCT4 antibody and rabbit polyclonal anti-E2F-1 antibody were supplied by Santa Cruz Biotechnology Inc. (Santa Cruz, CA, United States), and the rabbit polyclonal anti-pro-SP-C antibody and phycoerythrin-conjugated mouse monoclonal CD133/2 antibody were obtained from Merck Millipore (Billerica, MA, United States) and Miltenyi Biotec GmbH (Bergisch Gladbach, Germany), respectively. The goat anti-Musashi-1 (MSI1) antibody was obtained from R and D Systems (McKinley Place, MN, United States). The Cy3-labeled mouse monoclonal anti-EF5 antibody (ELK3-51) was kindly provided by Dr. Koch at Pennsylvania State University.
Reverse transcription (RT) was performed in a 10 μL reaction mixture containing 1 μg of total RNA, which was extracted with guanidinium thiocyanate, 250 ng of oligo(dT), and 100 units of murine leukemia virus reverse transcriptase (Life Technologies, Carlsbad, CA, United States) for 1 h at 37 °C. The resulting cDNA was used to amplify target cDNAs using GoTaq DNA polymerase (Agilent Technologies, Santa Clara, CA, United States). The sense and antisense primers used for polymerase chain reaction (PCR) are listed in Table 1. The PCR conditions were as follows: 95 °C for 5 min; 25-35 cycles at 95 °C for 30 s, 59 °C for 30 s, and 72 °C for 30 s; and 72 °C for 7 min. β-Actin was used as a loading control, which was run for each sample under the same conditions as those used for the other genes, except that the number of cycles was 23-25. PCR products were separated on a 1.2% agarose gel. Quantification of the density of each band was performed using ImageJ version 1.45 software (National Institutes of Health).
| Gene | Forward primer | Reverse primer | Accession # |
| CC10 | CTTTCAGCGTGTCATCGAAA | TTGAAGAGAGCAAGGCTGGT | U01101 |
| SP-C | TCCACATGAGCCAGAAACAC | CTGGCCCAGCTTAGACGTAG | NM_003018 |
| AQP5 | CTACTTCACTGGCTGCTCCA | GTGGTCAGCTCCATGGTCTT | NM_001651 |
| CD133 | TGGAGTGCAGCTAACATGAG | TGCACATGAAAAGACCTGGG | NM_006017 |
| 4-Oct | GAGGAGTCCCAGGACATCAA | CTCCAGGTTGCCTCTCACTC | NM_002701 |
| MSI1 | GTTCAGAGCGTTGGACCTTC | AAACCCAAAACACGAACAGC | NM_002442 |
| GLDC | ATTTCTCGTTGATCCCCGTTGC | GCGATGTCTACCCCAAATTCTC | NM_000170 |
| NANOG | ACCAGACCCAGAACATCCAG | TTCACACGTCTTCAGGTTGC | NM_024865 |
| NES | AACAGCGACGGAGGTCTCTA | TTCTCTTGTCCCGCAGACTT | NM_006617 |
| BMI1 | AGAGCTGGAAGTCGAGTGT | GCACCTTCACATTCCTCTC | NM_005180 |
| EGFR | GCACGAGTAACAAGCTCACG | TTCCTCTGATGATCTGCAGG | NM_005228 |
| ERBB2 | AGCAGAGGATGGAACACAGCGG | CTCCTGGATATTGGCACTGG | NM_004448 |
| NOTCH1 | TGCTGGACGAGTACAACCTG | CGCATTGACCATTCAAACTG | AF308602 |
| NOTCH2 | ACCCTTGTGAGAATGCTGCT | CCATACCACTGAAGCCTGGT | NM_024408 |
| CD117 | CTATGCTCTCGCACCTTTCC | CAATGAAGTGCCCCTGAAGT | X06182 |
| MET | GGTTTTTCCTGTGGCTGAAA | GGCATGAACCGTTCTGAGAT | NM_001127500 |
| CD34 | ACAACACGTGGTGGCTGATA | GAGTTTACCTGCCCCTCCTC | NM_001773 |
| CD44 | TGGAGCAAACACAACCTCTG | TCCACTTGGCTTTCTGTCCT | NM_000610 |
| CD45 | AGATGCCCAGTGTTCCAC | AGGGTTGAGTTTTGCATTGG | NM_002838 |
| PCGF2 | TTGCAGTGGAAACTTTGTGC | AGGTGAGACTCCACCACCAG | NM_007144 |
| CDH1 | GGTTATTCCTCCCATCAGCT | CTTGGCTGAGGATGGTGTA | L08599 |
| SOX2 | CCCCCCTGTGGTTACCTCTTC | TTCTCCCCCCTCC AGTTCG-3 | NM_003106 |
| RUNX3 | GCTGTTATGCGTATTCCCGTAG | TGAAGTGGCTTGTGGTGCTGAGTGA | NM_001031680 |
| ACTB | TGACGGGGTCACCCACACTGTGCCCATCTA | CTAGAAGCATTTGCGGTGGACGATGGAGGG | NM_001101 |
Transfection of the plasmid encoding constitutively active HIF-1α
To express constitutively active HIF-1α, A549 cells were transfected with pcDNA3.1 as a control and pcDNA3.1/HIF-1αP402A/P564A using Lipofectamine 2000 (Life Technologies). Two days after transfection, total RNA was prepared as described above and used for RT-PCR analysis.
Cells were lysed in 1% NP-40.1% sodium deoxycholate, 0.1% sodium dodecylsulfate, 50 mmol/L Tris-HCl (pH 7.4), 150 mmol/L NaCl, 1 mmol/L PMSF, and protease inhibitor cocktail (Sigma-Aldrich). The cell lysates were centrifuged at 15000 g for 10 min at 4 °C, and the supernatants were used for detecting SP-C and CD133. Nuclear extracts were prepared by using a Nuclear Extract Kit (Active Motif, Carlsbad, CA, United States) and were then used for detecting HIFs, OCT4 and MSI1. Proteins were resolved by 10% or 15% SDS-PAGE gels and transferred to an Immobilon-P membrane (Merck Millipore). The membrane was blocked with 5% dry milk in TBS-T and incubated with anti-HIF-1α, anti-HIF-2α, anti-SP-C, anti-CD133, anti-OCT4, anti-MSI1 or anti-E2F-1 antibodies followed by incubation with the appropriate horseradish peroxidase-conjugated secondary antibody. Proteins were detected using ECL Western blotting detection reagents (GE Healthcare, Waukesha, WI, United States).
To evaluate the effect of hypoxia on pneumosphere formation, cells pre-cultured under 4% O2 for 4 d were suspended at a density of 2000 cells/mL in BEBM (bronchial epithelial cell growth) medium (Lonza, Walkersville, MD, United States) supplemented with SingleQuots, which contains retinoic acid, bovine pituitary extract, insulin, hydrocortisone, transferrin, triiodothyronine, epinephrine, gentamicin, and amphotericin B (Lonza), as well as 10 ng/mL human epidermal growth factor (EGF) (PeproTech Inc., NJ, United States), and 10 ng/mL human basic fibroblast growth factor (bFGF) (PeproTech)[34]. Cells were incubated in PrimeSurface culture dishes (35 mm) (Sumitomo Bakelite Co., Tokyo, Japan) under normoxic or hypoxic (4% O2) conditions for 10 d. EGF and bFGF were added every 3 d. The size of the spheres was calculated by the following equation: size (μm) = (a + b)/2; where a and b are the larger and smaller diameters, respectively.
The survival of A549 cells treated with TX-402 under normoxic or hypoxic conditions was determined in a colony formation assay. For this assay, A549 cells dissociating to single cells were seeded in a 6-well plate at a density of 5 × 104 cells per well in 2 mL of medium. After attachment, the cells were cultured under normoxic or hypoxic conditions in the presence of DMSO (0.1%) or TX-402 (final concentration of 20 μmol/L) for 3 d. After the treatment, viable cells were counted and seeded in a 10-cm culture dish at a concentration of 100 cells/dish. The cells were further cultured for 14 d under normoxic conditions, and the colonies that were formed were fixed with methanol, stained with 0.05% crystal violet, and counted.
A549 cells on cover slips were washed with Dulbecco’s phosphate-buffered saline (DPBS) and fixed for 30 min with 4% formaldehyde and 5% sucrose in DPBS. After washing with DPBS, the cells were permeabilized in 0.5% Triton X-100 in DPBS for 10 min followed by washing three times with DPBS. In some experiments, this permeabilization step was omitted. The cells were then treated with 3% bovine serum albumin (BSA) in DPBS containing 0.1% glycine for 1 h to block nonspecific binding sites. After extensive washing, the cells were incubated with anti-SP-C, anti-CD133, anti-OCT4 or anti-MSI1 antibodies in DPBS containing 1 mg/mL BSA and 0.1% (v/v) normal rabbit serum, normal goat serum or normal chicken serum depending on the secondary antibody at 4 °C overnight. Primary antibodies were omitted for negative control studies. After washing with DPBS, the first antibodies were localized with the appropriate secondary antibodies. The secondary antibodies used were FITC-goat anti-rabbit IgG, TRITC-goat anti-rabbit IgG, Alexa Fluor 488-goat anti-rabbit IgG, and Alexa Fluor 488-chicken anti-goat IgG. After rinsing, the cells were counterstained with DAPI (1 μg/mL) in DPBS, and the coverslips were mounted in 50% glycerol in DPBS containing 1 mg/mL p-phenylenediamine to inhibit photobleaching. The cells were observed under a confocal laser microscope (Fluoview, Olympus, Tokyo, Japan).
All animal experiments were performed in compliance with the institutional guidelines. A549 cells (5 × 106 cells) were inoculated subcutaneously into Balb/c nude mice. When an estimated tumor volume reached approximately 500 mm3, 300 μL of EF5 solution (3 mg/mL) was administered intraperitoneally into the mice. Two hours later, subcutaneous tumors were surgically removed and frozen in optimum cutting temperature compound. Cryostat sections cut at a thickness of 10 μm were fixed with 4% paraformaldehyde and washed with DPBS. For the detection of CD133, tissue samples were treated with 5% donkey serum in DPBS/1% (w/v) BSA/20% (w/v) dry milk for 1 h to block nonspecific binding sites. Sections were then rinsed with DPBS and incubated with an anti-CD133 antibody overnight at 4 °C. After extensive washing with DPBS, the sections were incubated with a FITC-labeled donkey anti-goat secondary antibody for 1 h. After fixation with 4% formaldehyde, the sections were washed with DPBS, treated with 5% mouse serum in DPBS/20% (w/v) dry milk/0.3% (v/v) Tween 20 overnight at 4 °C, rinsed with 0.3% Tween 20 in DPBS, and then incubated with Cy3-labeled anti-EF5 antibody (ELK3-51) at 4 °C overnight to detect hypoxic cells. Tissue sections were counterstained with DAPI and observed under a confocal laser microscope (Fluoview, Olympus).
For the lung-colonizing assay, A549 cells (2 × 105 cells) cultured under normoxic or hypoxic (1% O2) conditions for 3 or 5 d were injected into the tail vein of 6-wk-old Balb/c nude mice (CLEA Japan, Inc.). The lungs were removed 40 d later and fixed in Bouin’s solution, and the parietal nodules were counted. For histology, formalin-fixed, paraffin-embedded lung tissues were sectioned at a thickness of 5 μm, mounted, and stained with hematoxylin and eosin.
The Mann-Whitney U test and Student’s t-test were used to determine statistical significance in metastasis assays and other assays, respectively. P values less than 0.05 were considered statistically significant.
We examined the expression of lineage-specific differentiation marker genes for Clara (CC10), AT1 (AQP5), and AT2 (SP-C) cells as well as several stem cell-related genes (CD133, OCT4, MSI1, SOX2 and GLDC) in various types of lung cancer cell lines (Figure 1). Among the adenocarcinoma cell lines, PC3 and PC14 cells expressed CC10, and A549 cells primarily expressed SP-C. PC9 cells expressed CC10, SP-C, and AQP5. Among the squamous carcinoma cell lines, SP-C was detected only in PC1 cells. QG56 cells were positive for CC10 and AQP5, but PC10 cells expressed none of the markers. By comparison, bronchoalveolar carcinoma H358 cells expressed all of the lineage-specific differentiation marker genes. Small cell carcinoma PC6 and QG90 cells expressed high levels of CC10. The stem cell-related gene, CD133, was expressed at higher levels in PC3, A549 and QG56 cells compared to the other cells. All cell lines were OCT4-positive/MSI1-positive. The expression of SOX2 was detected in all cell lines except PC9 cells. GLDC was highly expressed in PC14 and A549 cells compared with other cell lines. Taken together, these results suggest that there is not a simple causal relationship between the expression of the differentiation marker genes and the expression of the stem cell-related genes. For subsequent analyses, we mostly used A549 and QG56 cells.
We first confirmed the expression of HIF-1α and HIF-2α in A549 and QG56 cells at the mRNA level (Figure 2A). We then cultured these cells under normoxic or hypoxic conditions for up to 5 d and monitored cell growth and viability. The growth of A549 cells under hypoxic conditions was slightly inhibited by 4 d after the onset of hypoxia compared with their growth under normoxic conditions (Figure 2B). No cell death was observed in hypoxic conditions (Figure 2D). Hypoxia also slightly inhibited the growth of QG56 cells but had no detectable effect on viability (Figure 2C, D). Because these hypoxic conditions did not appear to be cytotoxic, we cultured A549 and QG56 cells under hypoxia, and we then examined the expression levels of SP-C, CC10, and AQP5. As described above, normoxic A549 cells primarily expressed SP-C and small amounts of CC10 and AQP5 (Figure 3A). Upon hypoxic exposure, the expression level of these genes was greatly reduced in a time-dependent manner (Figure 3A, B, D). QG56 cells mainly expressed CC10 and AQP5 (Figure 3A), and the expression level of these genes was greatly reduced in a time-dependent manner after exposure to hypoxia (Figure 3A, C, E).
The above results prompted us to compare in detail the expression of a panel of stem cell-related genes between normoxic and hypoxic cells. Among the genes tested, the expression levels of CD133, OCT4, and MSI1 were increased by hypoxia in A549 cells (Figure 4A left, B, C) in a time-dependent manner (Figure 4F). NANOG and CD117 were also slightly upregulated by hypoxia. The expression of other genes, including SOX2, GLDC, NES, BMI1, EGFR, ERBB2, NOTCH1, NOTCH2, CD34, CD44, CD45, PCGF2 (MEL18), and CDH1 (E-cadherin), was detected in A549 cells and was only marginally affected by hypoxia (Figure 4A, B). Hypoxia also enhanced the expression of CD133, OCT4, and MSI1 in QG56 cells, but to a lesser extent than in A549 cells (Figure 4A, D, E). Time-course experiments revealed that the expression of OCT4, CD133, and MSI1 gradually increased under hypoxia (Figure 4G). Unlike in A549 cells, NANOG expression was already high in QG56 cells and was not affected by hypoxia. The expression of NES was slightly upregulated by hypoxia, but the expression of SOX2, BMI1, EGFR, ERBB2, NOTCH1, NOTCH2, CD34, CD44, CD45, PCGF2, and CDH1 was unaffected. The expression level of GLDC was quite low in these cells (Figure 4A, D).
The ability to form spheres in serum-free culture conditions has been considered to be an important marker that represents the subset population of CSC-like cells[35]. We tested the ability of A549 and QG56 cells to form spheres under normoxic and hypoxic conditions. In this experiment, we allowed the cells to form spheres in 4% O2 to minimize the inhibitory effect of hypoxia (1% O2) on cell growth. Cell growth in complete medium was not inhibited in 4% O2 (Figure 5A) and the changes in the expression of SP-C, CD133, OCT4, and MSI1 were similar to those observed in 1% O2 (Figure 5B). The ability of A549 cells to form spheres was markedly increased under hypoxic conditions. Hypoxic cells formed larger spheres than normoxic cells (Figure 5C left, D). QG56 cells formed only loosely attached cell aggregates under normoxic conditions, but they formed more compact aggregates under hypoxic conditions (Figure 5C right). Taken together with the gene expression results, these data suggest that hypoxia can strongly induce the dedifferentiation of A549 cells but can only weakly induce the dedifferentiation of QG56 cells.
We examined SP-C and CD133 protein expression in A549 cells to examine the effect of hypoxia on a representative differentiation marker and a stem cell-associated marker, respectively. Immunofluorescence studies revealed that SP-C expression in normoxic A549 cells (some of which exhibited plasma membrane staining as indicated by arrowheads in Figure 6A), was significantly reduced in hypoxic A549 cells (Figure 6A). In contrast, CD133 expression was enhanced in hypoxic cells compared to normoxic cells (Figure 6B). These results were also confirmed by immunoblot analysis (Figure 6C, D). To examine whether the up-regulation of CD133 was located in hypoxic regions in tumors, we immunostained cryosections prepared from A549 subcutaneous tumors with an anti-CD133 antibody. To detect hypoxic cells in tumors, we injected EF5 intraperitoneally into tumor-bearing mice 2 h before the surgical removal of the tumor masses. Double-immunostaining of the sections with an anti-CD133 antibody and an anti-EF5 antibody revealed that CD133 expression was upregulated in some, but not all, hypoxic (EF5-positive) cells compared to normoxic (EF5-negative) cells (Figure 6E).
To investigate whether the hypoxia-induced changes in the expression of SP-C, CD133, OCT4, and MSI1 were mediated by HIFs, we treated A549 cells with DFO, a hypoxia mimetic. DFO treatment induced a decrease in the expression of SP-C and an increase in the expression of CD133, OCT4, and MSI1 (Figure 7A, B). Cobalt chloride, which is another hypoxia mimetic, induced similar changes in A549 cells (Figure 7C, D). To obtain more direct evidence of the importance of HIFs in hypoxia-induced changes, we transfected A549 cells with plasmids constitutively expressing CA-HIF-1α (pcDNA3.1/HIF-1αP402A/P564A). CA-HIF-1α overexpression resulted in a decrease in SP-C expression and an increase in CD133 and MSI1 expression (Figure 7E, F). The expression of OCT4 did not change, which was consistent with the report that OCT4 is a direct target of HIF-2α but not HIF-1α[9]. These results indicate that HIF-1 induces changes in the expression of SP-C, CD133, and MSI1.
To gain some insight into the mechanism underlying the HIF-mediated suppression of SP-C expression in A549 cells, we examined the effects of trichostatin A (TSA), a histone deacetylase (HDAC) inhibitor, and 5-azacytidine, an inhibitor of DNA methyltransferase. We showed that TSA but not 5-azacytidine efficiently diminished the suppressive effect of hypoxia on SP-C expression (Figure 7G, H), thereby suggesting that HDAC is involved in hypoxia-induced gene expression changes in A549 cells.
TX-402 inhibits the expression of HIF-1αand HIF-2αand restores the hypoxia-induced gene expression changes in A549 cells
TX-402 has been shown to inhibit the expression of HIF-1α protein[26-28], but its effect on HIF-2α protein expression remains to be tested. Thus we examined whether TX-402 inhibited the expression of HIF-1α and HIF-2α in A549 cells under hypoxic conditions. HIF-1α and HIF-2α accumulated after incubating the cells under hypoxic conditions for 9 h. Treatment with 20 μmol/L TX-402 significantly suppressed the accumulation of both subunits, but the levels of HIF-1α and HIF-2α mRNA were unaffected (Figure 8A, B).
The proliferation of A549 cells was inhibited by TX-402 (IC50 value of approximately 20 μmol/L) without any discernible cell killing under hypoxic conditions over a culture period of 3 d (Figure 8C). We then treated the cells under hypoxic conditions for 3 d in the presence of 20 μmol/L TX-402 and examined the expression of SP-C, CD133, OCT4, and MSI1. We found that TX-402 restored the expression levels of SP-C, CD133, OCT4, and MSI1 in hypoxia to the normoxic levels (Figure 8D). These results were also corroborated by an immunofluorescence study (Figure 8E). We detected nuclear OCT4 and MSI1 using nuclear extracts and found that TX-402 restored the levels of OCT4 and MSI1 in hypoxia to their normoxic levels (Figure 8F).
We examined the lung-colonizing potential of A549 cells that were cultured under hypoxic conditions after injecting them into the tail veins of nude mice. As evidenced by macroscopic and histological observations, hypoxic A549 cells formed a larger number of metastatic foci in the lungs than did normoxic A549 cells (Figure 9A, B). The lung-colonizing ability of hypoxic A549 cells was abolished by TX-402 (Figure 9C, D). To exclude the possibility that this suppressing effect of TX-402 was due to impaired colony-forming ability and enhanced senescence induction, we examined the effect of TX-402 on the colony-forming ability of A549 cells. Although the colony-forming ability of the cells that were treated with 20 μmol/L TX-402 under hypoxic conditions for 3 d was slightly but significantly inhibited (Figure 9E, F), the inhibitory effect of TX-402 on the lung-colonizing ability was more profound.
Here we show that A549 cells primarily express SP-C, which indicates that most of these cells are in the AT2 cell lineage. These cells also express the CD133, OCT4, MSI1, SOX2, and GLDC stem cell markers, suggesting that A549 cells comprise subpopulations of stem and progenitor cells. The exposure of A549 cells to hypoxia had the following effects without any sign of cell death: suppression of the expression of SP-C; upregulation of the expression of CD133, OCT4 and MSI1; and slight upregulation of the expression of NANOG. A549 cells have been shown to form iPSC-like colonies when introduced to Oct4, Sox2, Nanog and Lin28 together with a non-degradable form of HIFs[35]. Our results were in agreement with these data and further provide important information that tumor hypoxia itself can render CSC-like NSCLC cells.
Recent studies have shown that CD133-positive tumor cells exhibit higher tumorigenicity, clonogenicity, and metastatic ability than CD133-negative cells in different types of cancers, including primary non-small cell and small cell lung cancers[36-41]. Therefore, the hypoxia-induced expression of CD133 might partly contribute to the CSC-like phenotype of hypoxic A549 cells. OCT4 is overexpressed in bladder cancer, and ectopic expression of OCT4 blocks progenitor-cell differentiation and causes dysplasia in epithelial tissues[42,43]. Furthermore, recent reports have demonstrated that OCT4 expression is associated with the differentiation state of various cancer cells[44,45], and that it is essential for the successful reprogramming of somatic cells to induced pluripotent stem cells[46]. NANOG functions to maintain the pluripotency and co-expression of OCT4, and it is necessary for inducing the CSC-like properties of A549 cells[47]. MSI1 is an RNA-binding protein that is linked to asymmetric cell division[48]. Based on these reports, our results suggest that hypoxia induces the dedifferentiation of A549 cells. However, although we found that A549 cells express GLDC, its expression was not influenced by hypoxia. Because murine BASCs are SP-C/CC10 double-positive[17,18,48] and the recently identified putative mouse lung stem/progenitor cell population is CC10-positive/SP-C-negative[49], the properties of hypoxic A549 cells do not closely conform to those known to be characteristic of stem/progenitor cells.
The mechanism underlying the hypoxia-induced suppression of SP-C involves HIF-1α at least in part, because the overexpression of CA-HIF-1α suppressed SP-C expression. Because TSA reversed the suppressive effect of hypoxia, HDAC is also likely to be involved in the mechanism. Alternatively, because HIF-1α is post-translationally modified by acetylation of lysine residues within the N terminus leading to the stabilization of the protein[50], it is possible that TSA reduces the level of HIF-1α by directly acting at the protein level, which in turn restores hypoxia-induced SP-C repression to normal levels. In contrast, the upregulation of CD133, OCT4, and MSI1 in hypoxic A549 cells is undoubtedly mediated by HIFs because treatment with the hypoxia mimetics, namely DFO and CoCl2 (both of which stabilize HIF-α subunits) upregulated all of them. Furthermore, we showed that CA-HIF-1α overexpression up-regulated CD133 and MSI1 but not OCT4, which is an HIF-2α-specific target gene[11].
It is thought that CSCs display self-renewing ability, a high capacity for tumor initiation, and a high metastatic potential. We used sphere formation and lung-colonizing assays to examine whether hypoxic A549 cells also have these functional phenotypes. The lung-colonizing assay can examine the tumor-initiating capacity and growth of a single cell or a small mass of cells in orthotopic sites that mimic the in vivo niche conditions of CSCs in NSCLC. In the present study, we showed that hypoxic A549 cells formed larger spheres and more lung nodules after intravenous implantation compared to normoxic A549 cells. This result suggests that hypoxic A549 cells have high self-renewing activity, tumor-initiating capability, and/or metastatic ability. Thus, based on the gene expression data and functional studies, we conclude that hypoxia is able to induce subpopulations of A549 cells with CSC-like phenotypes.
To determine whether our findings could be generalized to other cell types, we also investigated the effect of hypoxia on QG56 cells, and we observed that the expression of the CC10 and AQP5 differentiation marker genes was markedly suppressed under hypoxic conditions. Inversely, CD133, OCT4, and MSI1 were up-regulated in hypoxic QG56 cells, and hypoxia weakly enhanced the sphere-forming capacity of QG56 cells. These results suggest that hypoxia also induces dedifferentiation of the cells.
An important finding of our study is that TX-402 blocked hypoxia-induced changes in the expression of the stem cell-related genes and an increase in the lung-colonizing ability of A549 cells, which most likely occurred via inhibition of the expression of HIF-α subunits. Although we observed a slight reduction in the survival of cells that were treated with TX-402 under hypoxic conditions, TX-402 was not cytotoxic at the concentration used. Therefore, it is likely that in addition to its growth-inhibitory effect in mild hypoxia, TX-402 inhibited the lung-colonizing ability of A549 cells by repressing cell dedifferentiation. Further studies using other NSCLC cell lines or primary patient samples are required to generalize the effects of TX-402 on dedifferentiation and lung-colonizing ability.
In conclusion, our results suggest that hypoxia induces the dedifferentiation of NSCLC cells into CSC-like cells with high metastatic potential and that HIF inhibitors, such as TX-402, may prevent this process. Recent studies have demonstrated that hypoxia in tumors can be induced by the administration of antiangiogenic agents, such as bevacizumab and VEGF receptor tyrosine kinase inhibitors, and that intermittent use of these drugs accelerates tumor growth and metastasis presumably by increasing the CSC population[6-8]. Therefore, combination therapy where antiangiogenic agents are combined with HIF-targeting drugs could be effective in improving patient outcomes. Thus, further studies on HIF-targeting drugs are warranted to determine their full potential in the treatment of disease.
We thank Dr. N. Koshikawa for helpful discussions.
Hypoxia influences many aspects of cancer cell biology, including neoangiogenesis, energy metabolism, cell survival, radiosensitivity, chemosensitivity, differentiation and invasion/metastasis, via hypoxia-inducible factors (HIFs). Hypoxia also induces the dedifferentiation of some tumor cells, rendering them more cancer stem cell (CSC)-like and metastatic.
The effects of hypoxia on the dedifferentiation and maintenance of CSC phenotypes of non-small cell lung cancer (NSCLC) is largely unknown. Furthermore, it remains to be examined whether HIF inhibitors can suppress the hypoxia-induced process.
In this study, the authors demonstrate that hypoxia induces the dedifferentiation of NSCLC and that TX-402, a small-molecule inhibitor of HIF-1α and HIF-2α expression, can suppress the hypoxia-induced process and, importantly, metastatic ability.
By understanding how tumor hypoxia induces the dedifferentiation of NSCLC, this study could represent a future strategy for therapeutic intervention in the treatment of patients with NSCLC.
Tumor hypoxia is generated in most solid tumors because of a shortage in oxygen supply. HIF is a transcription factor that is composed of HIF-α and HIF-β subunits, and it plays a central role in hypoxia-induced biological processes. CSCs are defined as those cells within a tumor that can self-renew, drive tumorigenesis, exhibit chemoresistance, exhibit radio-resistance, and have high metastatic potential.
The authors describe an inhibitor of the HIF-α subunit expression that suppresses the hypoxia-induced dedifferentiation of human NSCLC cells into CSC-like cells. This article was highly evaluated because the authors examined the hypoxic effect on NSCLC cells in detail.
| 1. | Semenza GL. Hypoxia-inducible factor 1 (HIF-1) pathway. Sci STKE. 2007;2007:cm8. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 699] [Cited by in RCA: 664] [Article Influence: 34.9] [Reference Citation Analysis (0)] |
| 2. | Semenza GL. Evaluation of HIF-1 inhibitors as anticancer agents. Drug Discov Today. 2007;12:853-859. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 271] [Cited by in RCA: 270] [Article Influence: 14.2] [Reference Citation Analysis (3)] |
| 3. | Coleman ML, Ratcliffe PJ. Oxygen sensing and hypoxia-induced responses. Essays Biochem. 2007;43:1-15. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 47] [Cited by in RCA: 40] [Article Influence: 2.1] [Reference Citation Analysis (0)] |
| 4. | Koshikawa N, Maejima C, Miyazaki K, Nakagawara A, Takenaga K. Hypoxia selects for high-metastatic Lewis lung carcinoma cells overexpressing Mcl-1 and exhibiting reduced apoptotic potential in solid tumors. Oncogene. 2006;25:917-928. [PubMed] |
| 5. | Durand RE, Sham E. The lifetime of hypoxic human tumor cells. Int J Radiat Oncol Biol Phys. 1998;42:711-715. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 45] [Cited by in RCA: 41] [Article Influence: 1.5] [Reference Citation Analysis (0)] |
| 6. | Ebos JM, Lee CR, Cruz-Munoz W, Bjarnason GA, Christensen JG, Kerbel RS. Accelerated metastasis after short-term treatment with a potent inhibitor of tumor angiogenesis. Cancer Cell. 2009;15:232-239. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 1449] [Cited by in RCA: 1394] [Article Influence: 82.0] [Reference Citation Analysis (4)] |
| 7. | Pàez-Ribes M, Allen E, Hudock J, Takeda T, Okuyama H, Viñals F, Inoue M, Bergers G, Hanahan D, Casanovas O. Antiangiogenic therapy elicits malignant progression of tumors to increased local invasion and distant metastasis. Cancer Cell. 2009;15:220-231. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 1930] [Cited by in RCA: 1886] [Article Influence: 110.9] [Reference Citation Analysis (6)] |
| 8. | Conley SJ, Gheordunescu E, Kakarala P, Newman B, Korkaya H, Heath AN, Clouthier SG, Wicha MS. Antiangiogenic agents increase breast cancer stem cells via the generation of tumor hypoxia. Proc Natl Acad Sci USA. 2012;109:2784-2789. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 553] [Cited by in RCA: 510] [Article Influence: 36.4] [Reference Citation Analysis (4)] |
| 9. | Semenza GL, Jiang BH, Leung SW, Passantino R, Concordet JP, Maire P, Giallongo A. Hypoxia response elements in the aldolase A, enolase 1, and lactate dehydrogenase A gene promoters contain essential binding sites for hypoxia-inducible factor 1. J Biol Chem. 1996;271:32529-32537. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1443] [Cited by in RCA: 1359] [Article Influence: 45.3] [Reference Citation Analysis (4)] |
| 10. | Keith B, Simon MC. Hypoxia-inducible factors, stem cells, and cancer. Cell. 2007;129:465-472. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 993] [Cited by in RCA: 919] [Article Influence: 48.4] [Reference Citation Analysis (5)] |
| 11. | Covello KL, Kehler J, Yu H, Gordan JD, Arsham AM, Hu CJ, Labosky PA, Simon MC, Keith B. HIF-2alpha regulates Oct-4: effects of hypoxia on stem cell function, embryonic development, and tumor growth. Genes Dev. 2006;20:557-570. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 610] [Cited by in RCA: 635] [Article Influence: 31.8] [Reference Citation Analysis (0)] |
| 12. | Holmquist L, Löfstedt T, Påhlman S. Effect of hypoxia on the tumor phenotype: the neuroblastoma and breast cancer models. Adv Exp Med Biol. 2006;587:179-193. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 31] [Cited by in RCA: 30] [Article Influence: 1.5] [Reference Citation Analysis (0)] |
| 13. | Bannister LH. Respiratory system. Gray’s Anatomy. New York: Churchill Livingstone 1999; 1666-1672. |
| 14. | Hagen G, Wolf M, Katyal SL, Singh G, Beato M, Suske G. Tissue-specific expression, hormonal regulation and 5’-flanking gene region of the rat Clara cell 10 kDa protein: comparison to rabbit uteroglobin. Nucleic Acids Res. 1990;18:2939-2946. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 62] [Cited by in RCA: 72] [Article Influence: 2.0] [Reference Citation Analysis (0)] |
| 15. | Weaver TE, Whitsett JA. Function and regulation of expression of pulmonary surfactant-associated proteins. Biochem J. 1991;273:249-264. [PubMed] |
| 16. | Nielsen S, King LS, Christensen BM, Agre P. Aquaporins in complex tissues. II. Subcellular distribution in respiratory and glandular tissues of rat. Am J Physiol. 1997;273:C1549-C1561. [PubMed] |
| 17. | Kim CF, Jackson EL, Woolfenden AE, Lawrence S, Babar I, Vogel S, Crowley D, Bronson RT, Jacks T. Identification of bronchioalveolar stem cells in normal lung and lung cancer. Cell. 2005;121:823-835. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1796] [Cited by in RCA: 1608] [Article Influence: 76.6] [Reference Citation Analysis (1)] |
| 18. | Broers JL, Jensen SM, Travis WD, Pass H, Whitsett JA, Singh G, Katyal SL, Gazdar AF, Minna JD, Linnoila RI. Expression of surfactant associated protein-A and Clara cell 10 kilodalton mRNA in neoplastic and non-neoplastic human lung tissue as detected by in situ hybridization. Lab Invest. 1992;66:337-346. [PubMed] |
| 19. | Lieber M, Smith B, Szakal A, Nelson-Rees W, Todaro G. A continuous tumor-cell line from a human lung carcinoma with properties of type II alveolar epithelial cells. Int J Cancer. 1976;17:62-70. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 880] [Cited by in RCA: 952] [Article Influence: 19.0] [Reference Citation Analysis (0)] |
| 20. | Eramo A, Lotti F, Sette G, Pilozzi E, Biffoni M, Di Virgilio A, Conticello C, Ruco L, Peschle C, De Maria R. Identification and expansion of the tumorigenic lung cancer stem cell population. Cell Death Differ. 2008;15:504-514. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1158] [Cited by in RCA: 1255] [Article Influence: 66.1] [Reference Citation Analysis (0)] |
| 21. | Tirino V, Camerlingo R, Franco R, Malanga D, La Rocca A, Viglietto G, Rocco G, Pirozzi G. The role of CD133 in the identification and characterisation of tumour-initiating cells in non-small-cell lung cancer. Eur J Cardiothorac Surg. 2009;36:446-453. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 140] [Cited by in RCA: 156] [Article Influence: 9.2] [Reference Citation Analysis (0)] |
| 22. | Chen YC, Hsu HS, Chen YW, Tsai TH, How CK, Wang CY, Hung SC, Chang YL, Tsai ML, Lee YY. Oct-4 expression maintained cancer stem-like properties in lung cancer-derived CD133-positive cells. PLoS One. 2008;3:e2637. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 340] [Cited by in RCA: 379] [Article Influence: 21.1] [Reference Citation Analysis (0)] |
| 23. | Bertolini G, Roz L, Perego P, Tortoreto M, Fontanella E, Gatti L, Pratesi G, Fabbri A, Andriani F, Tinelli S. Highly tumorigenic lung cancer CD133+ cells display stem-like features and are spared by cisplatin treatment. Proc Natl Acad Sci USA. 2009;106:16281-16286. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 642] [Cited by in RCA: 644] [Article Influence: 37.9] [Reference Citation Analysis (0)] |
| 24. | Zhang WC, Shyh-Chang N, Yang H, Rai A, Umashankar S, Ma S, Soh BS, Sun LL, Tai BC, Nga ME. Glycine decarboxylase activity drives non-small cell lung cancer tumor-initiating cells and tumorigenesis. Cell. 2012;148:259-272. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 460] [Cited by in RCA: 543] [Article Influence: 38.8] [Reference Citation Analysis (4)] |
| 25. | Semenza GL. HIF-1 inhibitors for cancer therapy: from gene expression to drug discovery. Curr Pharm Des. 2009;15:3839-3843. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 83] [Cited by in RCA: 92] [Article Influence: 5.8] [Reference Citation Analysis (0)] |
| 26. | Nagasawa H, Mikamo N, Nakajima Y, Matsumoto H, Uto Y, Hori H. Antiangiogenic hypoxic cytotoxin TX-402 inhibits hypoxia-inducible factor 1 signaling pathway. Anticancer Res. 2003;23:4427-4434. [PubMed] |
| 27. | Nagasawa H, Uto Y, Kirk KL, Hori H. Design of hypoxia-targeting drugs as new cancer chemotherapeutics. Biol Pharm Bull. 2006;29:2335-2342. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 46] [Cited by in RCA: 40] [Article Influence: 2.1] [Reference Citation Analysis (0)] |
| 28. | Miyake K, Nishioka M, Imura S, Batmunkh E, Uto Y, Nagasawa H, Hori H, Shimada M. The novel hypoxic cytotoxin, TX-2098 has antitumor effect in pancreatic cancer; possible mechanism through inhibiting VEGF and hypoxia inducible factor-1α targeted gene expression. Exp Cell Res. 2012;318:1554-1563. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 18] [Cited by in RCA: 24] [Article Influence: 1.7] [Reference Citation Analysis (0)] |
| 29. | Zhang J, Cao J, Weng Q, Wu R, Yan Y, Jing H, Zhu H, He Q, Yang B. Suppression of hypoxia-inducible factor 1α (HIF-1α) by tirapazamine is dependent on eIF2α phosphorylation rather than the mTORC1/4E-BP1 pathway. PLoS One. 2010;5:e13910. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 40] [Cited by in RCA: 50] [Article Influence: 3.1] [Reference Citation Analysis (0)] |
| 30. | Weng Q, Zhang J, Cao J, Xia Q, Wang D, Hu Y, Sheng R, Wu H, Zhu D, Zhu H. Q39, a quinoxaline 1,4-Di-N-oxide derivative, inhibits hypoxia-inducible factor-1α expression and the Akt/mTOR/4E-BP1 signaling pathway in human hepatoma cells. Invest New Drugs. 2011;29:1177-1187. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 18] [Cited by in RCA: 21] [Article Influence: 1.3] [Reference Citation Analysis (0)] |
| 31. | Parmar K, Mauch P, Vergilio JA, Sackstein R, Down JD. Distribution of hematopoietic stem cells in the bone marrow according to regional hypoxia. Proc Natl Acad Sci USA. 2007;104:5431-5436. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 659] [Cited by in RCA: 653] [Article Influence: 34.4] [Reference Citation Analysis (0)] |
| 32. | Wang Y, Seimiya M, Kawamura K, Yu L, Ogi T, Takenaga K, Shishikura T, Nakagawara A, Sakiyama S, Tagawa M. Elevated expression of DNA polymerase kappa in human lung cancer is associated with p53 inactivation: Negative regulation of POLK promoter activity by p53. Int J Oncol. 2004;25:161-165. [PubMed] |
| 33. | Seng F, Ley K. Simple Synthesis of 3-Amino-1,2,4-benzotriazine 1,4-Dioxide. Angew Chem Int Ed Engl. 1972;11:1009-1010. [DOI] [Full Text] |
| 34. | Lee J, Kotliarova S, Kotliarov Y, Li A, Su Q, Donin NM, Pastorino S, Purow BW, Christopher N, Zhang W. Tumor stem cells derived from glioblastomas cultured in bFGF and EGF more closely mirror the phenotype and genotype of primary tumors than do serum-cultured cell lines. Cancer Cell. 2006;9:391-403. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1977] [Cited by in RCA: 1857] [Article Influence: 92.9] [Reference Citation Analysis (4)] |
| 35. | Mathieu J, Zhang Z, Zhou W, Wang AJ, Heddleston JM, Pinna CM, Hubaud A, Stadler B, Choi M, Bar M. HIF induces human embryonic stem cell markers in cancer cells. Cancer Res. 2011;71:4640-4652. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 418] [Cited by in RCA: 418] [Article Influence: 27.9] [Reference Citation Analysis (4)] |
| 36. | Singh SK, Clarke ID, Terasaki M, Bonn VE, Hawkins C, Squire J, Dirks PB. Identification of a cancer stem cell in human brain tumors. Cancer Res. 2003;63:5821-5828. [PubMed] |
| 37. | Collins AT, Berry PA, Hyde C, Stower MJ, Maitland NJ. Prospective identification of tumorigenic prostate cancer stem cells. Cancer Res. 2005;65:10946-10951. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 2170] [Cited by in RCA: 2004] [Article Influence: 95.4] [Reference Citation Analysis (0)] |
| 38. | O’Brien CA, Pollett A, Gallinger S, Dick JE. A human colon cancer cell capable of initiating tumour growth in immunodeficient mice. Nature. 2007;445:106-110. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 3259] [Cited by in RCA: 2996] [Article Influence: 157.7] [Reference Citation Analysis (248)] |
| 39. | Ricci-Vitiani L, Lombardi DG, Pilozzi E, Biffoni M, Todaro M, Peschle C, De Maria R. Identification and expansion of human colon-cancer-initiating cells. Nature. 2007;445:111-115. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 3239] [Cited by in RCA: 2997] [Article Influence: 157.7] [Reference Citation Analysis (7)] |
| 40. | Yin S, Li J, Hu C, Chen X, Yao M, Yan M, Jiang G, Ge C, Xie H, Wan D. CD133 positive hepatocellular carcinoma cells possess high capacity for tumorigenicity. Int J Cancer. 2007;120:1444-1450. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 446] [Cited by in RCA: 430] [Article Influence: 22.6] [Reference Citation Analysis (0)] |
| 41. | Bertolini G, Roz L, Perego P, Tortoreto M, Fontanella E, Gatti L, Pratesi G, Fabbri A, Andriani F, Tinelli S. Highly tumorigenic lung cancer CD133+ cells display stem-like features and are spared by cisplatin treatment. Proc Natl Acad Sci USA. 2009;106:16281-16286. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 642] [Cited by in RCA: 644] [Article Influence: 37.9] [Reference Citation Analysis (0)] |
| 42. | Atlasi Y, Mowla SJ, Ziaee SA, Bahrami AR. OCT-4, an embryonic stem cell marker, is highly expressed in bladder cancer. Int J Cancer. 2007;120:1598-1602. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 211] [Cited by in RCA: 197] [Article Influence: 10.4] [Reference Citation Analysis (0)] |
| 43. | Hochedlinger K, Yamada Y, Beard C, Jaenisch R. Ectopic expression of Oct-4 blocks progenitor-cell differentiation and causes dysplasia in epithelial tissues. Cell. 2005;121:465-477. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 724] [Cited by in RCA: 655] [Article Influence: 31.2] [Reference Citation Analysis (3)] |
| 44. | Chen Y, Shi L, Zhang L, Li R, Liang J, Yu W, Sun L, Yang X, Wang Y, Zhang Y. The molecular mechanism governing the oncogenic potential of SOX2 in breast cancer. J Biol Chem. 2008;283:17969-17978. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 257] [Cited by in RCA: 286] [Article Influence: 15.9] [Reference Citation Analysis (0)] |
| 45. | Zhang X, Han B, Huang J, Zheng B, Geng Q, Aziz F, Dong Q. Prognostic significance of OCT4 expression in adenocarcinoma of the lung. Jpn J Clin Oncol. 2010;40:961-966. [PubMed] [DOI] [Full Text] |
| 46. | Kumar SM, Liu S, Lu H, Zhang H, Zhang PJ, Gimotty PA, Guerra M, Guo W, Xu X. Acquired cancer stem cell phenotypes through Oct4-mediated dedifferentiation. Oncogene. 2012;31:4898-4911. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 263] [Cited by in RCA: 259] [Article Influence: 18.5] [Reference Citation Analysis (0)] |
| 47. | Chiou SH, Wang ML, Chou YT, Chen CJ, Hong CF, Hsieh WJ, Chang HT, Chen YS, Lin TW, Hsu HS. Coexpression of Oct4 and Nanog enhances malignancy in lung adenocarcinoma by inducing cancer stem cell-like properties and epithelial-mesenchymal transdifferentiation. Cancer Res. 2010;70:10433-10444. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 448] [Cited by in RCA: 492] [Article Influence: 32.8] [Reference Citation Analysis (0)] |
| 48. | Potten CS, Booth C, Tudor GL, Booth D, Brady G, Hurley P, Ashton G, Clarke R, Sakakibara S, Okano H. Identification of a putative intestinal stem cell and early lineage marker; musashi-1. Differentiation. 2003;71:28-41. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 393] [Cited by in RCA: 346] [Article Influence: 15.0] [Reference Citation Analysis (0)] |
| 49. | Ling TY, Kuo MD, Li CL, Yu AL, Huang YH, Wu TJ, Lin YC, Chen SH, Yu J. Identification of pulmonary Oct-4+ stem/progenitor cells and demonstration of their susceptibility to SARS coronavirus (SARS-CoV) infection in vitro. Proc Natl Acad Sci USA. 2006;103:9530-9535. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 130] [Cited by in RCA: 120] [Article Influence: 6.0] [Reference Citation Analysis (0)] |
| 50. | Geng H, Harvey CT, Pittsenbarger J, Liu Q, Beer TM, Xue C, Qian DZ. HDAC4 protein regulates HIF1α protein lysine acetylation and cancer cell response to hypoxia. J Biol Chem. 2011;286:38095-38102. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 135] [Cited by in RCA: 179] [Article Influence: 11.9] [Reference Citation Analysis (0)] |
P- Reviewers: Javier C, Kanno H, Scatena R S- Editor: Qi Y L- Editor: A E- Editor: Liu XM