Copyright
©The Author(s) 2015.
World J Clin Infect Dis. Nov 25, 2015; 5(4): 86-93
Published online Nov 25, 2015. doi: 10.5495/wjcid.v5.i4.86
Published online Nov 25, 2015. doi: 10.5495/wjcid.v5.i4.86
Table 1 Primers and probes used in this study
Gene | Forward primer 5'-3' | Reverse primer 5'-3' | Probe 5'-3' | Ref. |
tuf | tcctggttcaattacaccacatactg | ggaaatagaattgtggacgatagtttga | FAM-tgataatacrtawacttctgc-BHQ1 | [24] |
16S | acggtcttgctgtcactta | tacacatatgttcttccctaataa | VIC-gtaacggcttaccaaggc-BHQ1 | [22] |
Table 2 Plate counts of Staphylococcus aureus samples with or without flucloxacillin treatment from Todd Hewitt broth
Flucloxacillin | Yes | No | |||
Average | SD | Average | SD | ||
Days | 0 | 290 | 14 | 330 | 28 |
1 | 255 | 7 | Infinity | ND | |
3 | 0 | 0 | Infinity | ND | |
6 | 0 | 0 | Infinity | ND |
Table 3 Plate counts of Staphylococcus aureus with or without flucloxacillin treatment from Todd Hewitt broth, fresh whole blood (1 h) and remnant whole blood (1 d)
TH broth | Fresh whole blood | Remnant whole blood | |||||
Flucloxacillin | Yes | No | Yes | No | Yes | No | |
Days | 0 | 20 | 22 | 10 | 4 | 3 | 6 |
1 | 14 | Infinity | 2 | 3 | 1 | 1 | |
3 | 0 | Infinity | 2 | 1 | 0 | 3 | |
6 | 0 | Infinity | 1 | 0 | 0 | 0 |
-
Citation: Loonen AJ, Wolffs PF, de Bresser M, Habraken M, Bruggeman CA, Hermans MH, van den Brule AJ.
Tuf mRNA rather than 16S rRNA is associated with culturableStaphylococcus aureus . World J Clin Infect Dis 2015; 5(4): 86-93 - URL: https://www.wjgnet.com/2220-3176/full/v5/i4/86.htm
- DOI: https://dx.doi.org/10.5495/wjcid.v5.i4.86