©2013 Baishideng Publishing Group Co.
World J Clin Infect Dis. May 25, 2013; 3(2): 13-19
Published online May 25, 2013. doi: 10.5495/wjcid.v3.i2.13
Published online May 25, 2013. doi: 10.5495/wjcid.v3.i2.13
Table 1 Polymerase chain reaction primers used in this study
| Target parasite | Target gene | Primer | Primer sequence (5’-3’) | Annealingtemperature | PCR Product size (bp) | Ref |
| Giardia lamblia | Beta-giardin | MAH433F | CATAACGACGCCATCGCGGCTCTCAGGAA | 60 | 218 | Rochelle et al[19] |
| MAH592R | TTTGTGAGCGCTTCTGTCGTGGCAGCGCTAA | |||||
| Ascaris lumbricoides | rDNA | ITS-1F | TGCACATAAGTACTATTTGCGCGTAT | 60 | 82 | Pecson et al[20] |
| ITS-1R | TGATGTAATAGCAGTCGGCGG | |||||
| Entamoeba histolytica | SSU rRNA | EH1 | GTACAAAATGGCCAATTCATTCAATG | 51 | 128 | Gonin et al[21] |
| EH2 | ACTACCAACTGATTGATAGATCAG | |||||
| Cryptosporidium sp. | SSU rRNA | 18 SF | TTCTAGAGCTAATACATGCG | 55 | 1325 | Xiao et al[32] |
| 18 SR | CCCTAATCCTTCGAAACAGGA | |||||
| Cryptosporidium sp. | Nested PCR for SSU rRNA | GAAGGGTTGTATTTATTAGATAAAG | 55 | 825 | Xiao et al[32] | |
| AAGGAGTAAGGAACAACCTCCA |
Table 2 Characterization of enteric parasitic ova/(oo)cysts recovered from stool samples
| Parasites | Prevalence in parasitic ova/(oo)cystpositive stool samples | |
| Kolkata, India | Dhaka, Bangladesh | |
| (n = 113) | (n = 269) | |
| Intestinal protozoa | ||
| Giardia lamblia | 26% | 10% |
| Cryptosporidium hominis. | 10% | ND |
| Entamoeba histolytica | ND | 7% |
| Blastocystis hominis | ND | 7% |
| Iodamoeba butschlii | ND | 6% |
| Trichomonas hominus | ND | 0.50% |
| Soil-transmitted helminthes and schistosomes | ||
| Ascaris lumbricoides | 43% | 37% |
| Trichuris trichiura | ND | 20% |
| Hookworm | 12% | 0.50% |
| Hymenolepis nana | 2% | 1% |
| Taenia sp. | 2% | ND |
| Schistosoma sp. | 5% | ND |
Table 3 Identification of enteric parasites recovered from hand wash samples
| Parasites | Prevalence of enteric parasitic ova /(oo)cysts in hand wash samples | |||||||||
| Kolkata, India(n = 100) | Sex | Age (yr) | Dhaka, Bangladesh(n = 100) | Sex | Age (yr) | |||||
| M | F | ≤12 | > 12 | M | F | ≤12 | > 12 | |||
| Intestinal protozoa | ||||||||||
| Giardia lamblia | 31% | 64.5% | 35.50% | 35.50% | 64.5% | 19% | 86% | 14% | 100% | 0% |
| Cryptosporidium hominis. | 5% | 60% | 40% | 0% | 100% | 0% | 0% | 0% | 0% | 0% |
| Blastocystis hominis | ND | 0% | 0% | 0% | 0% | 5% | 0% | 100% | 0% | 100% |
| Iodamoeba butschlii | ND | 0% | 0% | 0% | 0% | 5% | 0% | 100% | 0% | 100% |
| Soil-transmitted helminthes and schistosomes | ||||||||||
| Ascaris lumbricoides | 53% | 47.10% | 52.90% | 56.60% | 43.40% | 47% | 68% | 32% | 100% | 0% |
| Trichuris trichiura | ND | 0% | 0% | 0% | 0% | 24% | 100% | 0% | 100% | 0% |
| Hookworm | 9% | 44.40% | 56.60% | 0% | 100% | 0% | 0% | 0% | 0% | 0% |
| Schistosoma sp. | 2% | 0% | 100% | 100% | 0% | 0% | 0% | 0% | 0% | 0% |
Table 4 Genotyping of enteric parasites isolated from stool and hand wash samples by DNA sequencing
| Enteric parasite studied | Number of samples studied | Number of samples genotyped with 100% similarity | |
| Stool | Hand wash | ||
| Giardia lamblia | 3 | 3 | 3 |
| Entamoeba Histolytica | 3 | 3 | 3 |
| Trichuris trichiura | 3 | 3 | 3 |
| Giardia lamblia | 5 | 5 | 5 |
| Ascaris sp. | 5 | 5 | 5 |
| Trichuris trichiura | 5 | 5 | 5 |
- Citation: Ijaz MK, Talukder KA, Aslam M, Haque R, Ganguly S, Azmi IJ, Hossain MS, Mukherjee AK, Raj D, Ahmed I, Kamal J, Rubino JR, Nur-E-Kamal A. Natural contamination of human hands with enteric parasites in Indian Subcontinent. World J Clin Infect Dis 2013; 3(2): 13-19
- URL: https://www.wjgnet.com/2220-3176/full/v3/i2/13.htm
- DOI: https://dx.doi.org/10.5495/wjcid.v3.i2.13
