Natural contamination of human hands with enteric parasites in Indian Subcontinent

Table 1 Polymerase chain reaction primers used in this study

Target parasite	Target gene	Primer	Primer sequence (5’-3’)	Annealingtemperature	PCR Product size (bp)	Ref
Giardia lamblia	Beta-giardin	MAH433F	CATAACGACGCCATCGCGGCTCTCAGGAA	60	218	Rochelle et al[19]
		MAH592R	TTTGTGAGCGCTTCTGTCGTGGCAGCGCTAA
Ascaris lumbricoides	rDNA	ITS-1F	TGCACATAAGTACTATTTGCGCGTAT	60	82	Pecson et al[20]
		ITS-1R	TGATGTAATAGCAGTCGGCGG
Entamoeba histolytica	SSU rRNA	EH1	GTACAAAATGGCCAATTCATTCAATG	51	128	Gonin et al[21]
		EH2	ACTACCAACTGATTGATAGATCAG
Cryptosporidium sp.	SSU rRNA	18 SF	TTCTAGAGCTAATACATGCG	55	1325	Xiao et al[32]
		18 SR	CCCTAATCCTTCGAAACAGGA
Cryptosporidium sp.	Nested PCR for SSU rRNA		GAAGGGTTGTATTTATTAGATAAAG	55	825	Xiao et al[32]
			AAGGAGTAAGGAACAACCTCCA

PCR: Polymerase chain reaction.

Table 2 Characterization of enteric parasitic ova/(oo)cysts recovered from stool samples

Parasites	Prevalence in parasitic ova/(oo)cystpositive stool samples
	Kolkata, India	Dhaka, Bangladesh
	(n = 113)	(n = 269)
Intestinal protozoa
Giardia lamblia	26%	10%
Cryptosporidium hominis.	10%	ND
Entamoeba histolytica	ND	7%
Blastocystis hominis	ND	7%
Iodamoeba butschlii	ND	6%
Trichomonas hominus	ND	0.50%
Soil-transmitted helminthes and schistosomes
Ascaris lumbricoides	43%	37%
Trichuris trichiura	ND	20%
Hookworm	12%	0.50%
Hymenolepis nana	2%	1%
Taenia sp.	2%	ND
Schistosoma sp.	5%	ND

Percentage of each type of parasite found in stool samples from Kolkata, India and Dhaka, Bangladesh. ND: Not detected.

Table 3 Identification of enteric parasites recovered from hand wash samples

Parasites	Prevalence of enteric parasitic ova /(oo)cysts in hand wash samples
	Kolkata, India(n = 100)	Sex		Age (yr)		Dhaka, Bangladesh(n = 100)	Sex		Age (yr)
		M	F	≤12	> 12		M	F	≤12	> 12
Intestinal protozoa
Giardia lamblia	31%	64.5%	35.50%	35.50%	64.5%	19%	86%	14%	100%	0%
Cryptosporidium hominis.	5%	60%	40%	0%	100%	0%	0%	0%	0%	0%
Blastocystis hominis	ND	0%	0%	0%	0%	5%	0%	100%	0%	100%
Iodamoeba butschlii	ND	0%	0%	0%	0%	5%	0%	100%	0%	100%
Soil-transmitted helminthes and schistosomes
Ascaris lumbricoides	53%	47.10%	52.90%	56.60%	43.40%	47%	68%	32%	100%	0%
Trichuris trichiura	ND	0%	0%	0%	0%	24%	100%	0%	100%	0%
Hookworm	9%	44.40%	56.60%	0%	100%	0%	0%	0%	0%	0%
Schistosoma sp.	2%	0%	100%	100%	0%	0%	0%	0%	0%	0%

A portion of concentrated samples were smeared on microscopic slides and examined microscopically and/or by polymerase chain reaction. Percentages of different types of enteric parasites found in hand wash samples are shown. ND: Not detected. M: Male; F: Female.

Table 4 Genotyping of enteric parasites isolated from stool and hand wash samples by DNA sequencing

Enteric parasite studied	Number of samples studied	Number of samples genotyped with 100% similarity
		Stool	Hand wash
Giardia lamblia	3	3	3
Entamoeba Histolytica	3	3	3
Trichuris trichiura	3	3	3
Giardia lamblia	5	5	5
Ascaris sp.	5	5	5
Trichuris trichiura	5	5	5

Similarities of enteric parasites (Giardia lamblia, Cryptosporidium sp., Ascaris lumbricoids, and Entamoeba histolytica) found among the stool and hand wash samples collected from same individuals.