©The Author(s) 2023.
World J Exp Med. Dec 20, 2023; 13(5): 102-114
Published online Dec 20, 2023. doi: 10.5493/wjem.v13.i5.102
Published online Dec 20, 2023. doi: 10.5493/wjem.v13.i5.102
Table 1 The association of microRNA-125a, tumor necrosis factor-alpha, and interleukin 12 with major clinical symptoms of systemic lupus erythematosus patients
| Characteristics | miR-125a | TNF-α | IL-12 | ||||
| Lupus nephritis | Yes | 0.199 ± 0.07 | P = 0.576 | 53.42 ± 14.44 | P = 0.153 | 122.37 ± 22.36 | P = 0.104 |
| No | 0.205 ± 0.09 | 45.60 ± 12.13 | 108.34 ± 29.87 | ||||
| Malar rash | Yes | 0.180 ± 0.06 | P = 0.017 | 54.60 ± 12.44 | P = 0.360 | 128.45 ± 20.28 | P = 0.065 |
| No | 0.216 ± 0.09 | 43.37 ± 11.51 | 102.42 ± 28.94 | ||||
| Hair loss | Yes | 0.188 ± 0.06 | P = 0.022 | 52.63 ± 13.08 | P = 0.401 | 126.87 ± 20.62 | P = 0.049 |
| No | 0.211 ± 0.09 | 44.34 ± 11.98 | 103.19 ± 29.48 | ||||
| SLEDAI | ≤ 4 | 0.202 ± 0.08 | P = 0.005 | 44.00 ± 14.71 | P = 0.001 | 102.43 ± 23.38 | P = 0.000 |
| 5-12 | 0.280 ± 0.08 | 30.49 ± 12.59 | 69.54 ± 32.43 | ||||
| ≥ 12 | 0.199 ± 0.09 | 49.11 ± 13.51 | 113.26 ± 28.54 | ||||
Table 2 List of primers for microRNA-125a and U6 internal control
| Primer | Sequence (5'>3') |
| miR-125a | F: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGT |
| R: GTCGTATCCAGTGCAGGGTCCGAGGTGCCGAGGATTTCCACCACCTG | |
| U6 | F: GCTTCGGCAGCACATATACTAAAAT |
| R: CGCTTCACGAATTTGCGTGTCAT |
- Citation: Alsbihawi TQ, Zare Ebrahimabad M, Seyedhosseini FS, Davoodi H, Abdolahi N, Nazari A, Mohammadi S, Yazdani Y. Altered expression of miR-125a and dysregulated cytokines in systemic lupus erythematosus: Unveiling diagnostic and prognostic markers. World J Exp Med 2023; 13(5): 102-114
- URL: https://www.wjgnet.com/2220-315X/full/v13/i5/102.htm
- DOI: https://dx.doi.org/10.5493/wjem.v13.i5.102
