Methylation status of leptin gene promoter in relatively lean Chinese adults with prediabetes and type 2 diabetes mellitus

Table 1 Primer sequences, lengths, and annealing temperatures for leptin gene PCR

Primer name primers sequence (5' to 3')		Annealing temperature (°C)	Primer length (bp)
Methylation	Upstream: TTGGCGTTTAGGGTCGTC	62	106
	Downstream: AACTCCGCGAAACGAACT
Non-methylation	Upstream: TTTTTGGTGTTTAGGGTTGTT	60	112
	Downstream: AAAAACTCCACAAAACAAACT

Table 2 Number of cases with leptin gene promoter methylation

Clinical classification	Number of cases (n)	Leptin gene methylation	Methylation rate (%)
		Positive (complete/incomplete), negative
Type 2 diabetes mellitus	178	56 (21/35), 122	31.5a,b,c
Impaired glucose regulation	94	41 (16/25), 53	43.6d
Impaired fasting glucose	44	17 (7/10), 27	38.6e
Impaired glucose tolerance	50	24 (11/13), 26	48
Normal glucose tolerance	120	71 (32/39), 49	59.2

^aP = 0.000, χ² = 22.499: vs normal glucose tolerance.

^bP = 0.047, χ² = 3.962: vs impaired glucose regulation.

^cP = 0.030, χ² = 4.688: vs impaired glucose tolerance.

^dP = 0.024, χ² = 5.109: vs normal glucose tolerance.

^eP = 0.019, χ² = 5.457: vs normal glucose tolerance.

Table 3 General clinical data and leptin protein expression, n (%)

	Impaired glucose regulation	Type 2 diabetes mellitus	Normal glucose tolerance
	Impaired fasting glucose, impaired glucose tolerance
Number (male/female)	44 (20/24), 50 (26/24)	178 (88/90)	120 (60/60)
Age (years)	49.4 ± 6.2, 47.2 ± 6.3	47.5 ± 5.5	46.7 ± 7.4
Body mass index (kg/m2)	22.37 ± 2.66, 23.23 ± 3.52	22.99 ± 2.53	21.19 ± 3.42
Leptin (μg/L)	13.79 ± 3.32, 12.62 ± 4.81	16.94 ± 4.19a	11.33 ± 3.10
Hypertension (%)	12 (27.3), 17 (34)	41 (23.1)	26 (21.7)
Smoking (%)	9 (20.5), 12 (26)	44 (24.7)	27 (22.5)

^aq = 6.81, P < 0.01 for leptin levels in type 2 diabetes mellitus group: vs normal glucose tolerance. Data presented as mean ± SD or percentage.