©The Author(s) 2025.
World J Diabetes. Dec 15, 2025; 16(12): 112789
Published online Dec 15, 2025. doi: 10.4239/wjd.v16.i12.112789
Published online Dec 15, 2025. doi: 10.4239/wjd.v16.i12.112789
Table 1 Primer sequences, lengths, and annealing temperatures for leptin gene PCR
| Primer name primers sequence (5' to 3') | Annealing temperature (°C) | Primer length (bp) | |
| Methylation | Upstream: TTGGCGTTTAGGGTCGTC | 62 | 106 |
| Downstream: AACTCCGCGAAACGAACT | |||
| Non-methylation | Upstream: TTTTTGGTGTTTAGGGTTGTT | 60 | 112 |
| Downstream: AAAAACTCCACAAAACAAACT | |||
Table 2 Number of cases with leptin gene promoter methylation
| Clinical classification | Number of cases (n) | Leptin gene methylation | Methylation rate (%) |
| Positive (complete/incomplete), negative | |||
| Type 2 diabetes mellitus | 178 | 56 (21/35), 122 | 31.5a,b,c |
| Impaired glucose regulation | 94 | 41 (16/25), 53 | 43.6d |
| Impaired fasting glucose | 44 | 17 (7/10), 27 | 38.6e |
| Impaired glucose tolerance | 50 | 24 (11/13), 26 | 48 |
| Normal glucose tolerance | 120 | 71 (32/39), 49 | 59.2 |
Table 3 General clinical data and leptin protein expression, n (%)
| Impaired glucose regulation | Type 2 diabetes mellitus | Normal glucose tolerance | |
| Impaired fasting glucose, impaired glucose tolerance | |||
| Number (male/female) | 44 (20/24), 50 (26/24) | 178 (88/90) | 120 (60/60) |
| Age (years) | 49.4 ± 6.2, 47.2 ± 6.3 | 47.5 ± 5.5 | 46.7 ± 7.4 |
| Body mass index (kg/m2) | 22.37 ± 2.66, 23.23 ± 3.52 | 22.99 ± 2.53 | 21.19 ± 3.42 |
| Leptin (μg/L) | 13.79 ± 3.32, 12.62 ± 4.81 | 16.94 ± 4.19a | 11.33 ± 3.10 |
| Hypertension (%) | 12 (27.3), 17 (34) | 41 (23.1) | 26 (21.7) |
| Smoking (%) | 9 (20.5), 12 (26) | 44 (24.7) | 27 (22.5) |
- Citation: Sun SQ, Liang SZ, Huang Q, Sun JZ. Methylation status of leptin gene promoter in relatively lean Chinese adults with prediabetes and type 2 diabetes mellitus. World J Diabetes 2025; 16(12): 112789
- URL: https://www.wjgnet.com/1948-9358/full/v16/i12/112789.htm
- DOI: https://dx.doi.org/10.4239/wjd.v16.i12.112789
