Copyright
©The Author(s) 2024.
World J Diabetes. Jun 15, 2024; 15(6): 1317-1339
Published online Jun 15, 2024. doi: 10.4239/wjd.v15.i6.1317
Published online Jun 15, 2024. doi: 10.4239/wjd.v15.i6.1317
Gene | Forward primers | Reverse primers |
HIF-1α | TGCTCATCAGTTGCCACTTCCAC | CACCCTGTTGCTGTAGCCAAA |
BNIP3 | AATAATGGGAACGGGGGCAG | CCCCCTTTCTTCATGACGCT |
NIX | CACACCAGCAGGGACCATAG | TGTGCTCAGTCGCTTTCCAA |
FUNDC1 | CCCCCTCCCCAAGACTATGA | TGCAAGTCCGAGCAAAAAGC |
PINK1 | AGTCCATTGGTAAGGGCTGC | AAATCTGCGATCACCAGCCA |
Parkin | AATCAGAGGGCTCTGGAGGT | TCATCCGAATGGACCGGATT |
GAPDH | TGACTTCAACAGCGACACCCA | CACCCTGTTGCTGTAGCCAAA |
No. | Title | RT (min) | Area | Ontology |
1 | Phosphatidylethanolamine lyso 22 | 13.94715 | 1899972.00 | 2-acyl-sn-glycero-3-phosphoethanolamines |
2 | Phosphatidylethanolamine lyso 18 | 15.32940 | 226900.40 | 2-acyl-sn-glycero-3-phosphoethanolamines |
3 | Citric acid | 1.820983 | 184061.70 | Tricarboxylic acids and derivatives |
4 | sn-Glycero-3-phosphocholine | 14.45802 | 144480.10 | Glycerophosphocholines |
5 | (2R,3R,6R,8R,9S,12S,13R,14R,15R,16R)-6,8,14,15-tetrahydroxy-2,6,13,16-tetramethyl-3-{[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy}-10-oxatetracyclo[7.6.1.0,.0,]hexadec-4-en-11-one | 14.30263 | 143726.20 | Eudesmanolides, secoeudesmanolides, and derivatives |
6 | Phosphatidylethanolamine lyso 20 | 13.50750 | 80798.77 | 2-acyl-sn-glycero-3-phosphoethanolamines |
7 | 2-[(4S,5S,5aS,9aS)-4-methoxy-6,6,9a-trimethyl-5-[(2E,4E,6E)-octa-2,4,6-trienoyl]oxy-1-oxo-4,5,5a,7,8,9-hexahydro-3H-benzo[e]isoindol-2-yl]pentanedioic acid | 15.12730 | 50046.63 | Glutamic acid and derivatives |
8 | Phosphatidylethanolamine lyso alkenyl 16 | 15.92828 | 20239.35 | Glycerophosphoethanolamines |
9 | USNIC ACID | 7.950984 | 17973.83 | Acetophenones |
10 | FORMONONETIN | 11.89108 | 16466.15 | 4’-O-methylisoflavones |
11 | PFCA-unsaturated | 1.420167 | 15911.72 | PFSA |
12 | 3-hydroxy-1a,5-bis(hydroxymethyl)-5,6b-dimethyl-1,3,3a,4,6,6a-hexahydrocyclopropa[e]inden-2-one | 11.26097 | 15753.38 | Cyclic alcohols and derivatives |
13 | 4-[5-[[4-[5-[acetyl(hydroxy)amino]pentylamino]-4-oxobutanoyl]-hydroxyamino]pentylamino]-4-oxobutanoic acid | 14.49665 | 426921.60 | N-acyl amines |
14 | LPE 16:0 | 14.81610 | 94029.74 | Lipids |
15 | Cytarabine | 1.46050 | 28727.73 | Pyrimidine nucleosides |
16 | Indole-3-acetyl-L-alanine | 7.712983 | 17271.44 | Amino acids |
17 | Taurocholic acid | 13.89302 | 14700.46 | Trihydroxy bile acids, alcohols, and derivatives |
18 | 10-Hydroxydecanoic acid | 11.39715 | 11104.43 | Medium-chain hydroxy acids and derivatives |
19 | Phosphatidylethanolamine lyso 16 | 15.29023 | 178188.7 | 2-acyl-sn-glycero-3-phosphoethanolamines |
20 | Actrarit | 6.760533 | 23273.13 | Benzene and substituted derivatives |
21 | Pyroglutamic acid | 1.820983 | 19421.45 | Alpha amino acids and derivatives |
22 | Atenolol acid | 11.30097 | 12153.77 | Phenol ethers |
23 | D-PANTOTHENIC ACID | 1.94130 | 22119.00 | Secondary alcohols |
24 | Acacetin | 18.55157 | 15547.79 | 4’-O-methylated flavonoids |
25 | (1R,6R,10S,11R,13S,15R)-1,6-dihydroxy-8-(hydroxymethyl)-4,12,12,15-tetramethyl-5-oxotetracyclo[8.5.0.0,.0,]pentadeca-3,8-dien-13-yl hexadecanoate | 14.02730 | 61856.96 | Phorbol esters |
26 | arctigenin | 11.81143 | 24300.10 | Dibenzylbutyrolactone lignans |
27 | 4-Hydroxy-4-methyl-2-pentanone | 20.19918 | 11647.11 | Beta-hydroxy ketones |
28 | 12-hydroxyeicosapentaenoic acid | 14.65860 | 84224.38 | Hydroxyeicosapentaenoic acids |
29 | (+/-)-Synephrine | 20.86260 | 72999.33 | 1-hydroxy-2-unsubstituted benzenoids |
30 | Phosphatidylcholine lyso 16 | 15.93340 | 59974.72 | 2-acyl-sn-glycero-3-phosphocholines |
31 | 4-O-Methylphloracetophenone | 1.17735 | 19537.06 | Alkyl-phenylketones |
32 | 5-Methoxy-3-indoleacetic acid | 8.153967 | 13901.50 | Indole-3-acetic acid derivatives |
33 | (1R,9S,10S)-3,4-dihydroxy-11,11-dimethyl-5-(propan-2-yl)-16-oxatetracyclo[7.5.2.0,.0,]hexadeca-2(7),3,5-triene-8,15-dione | 15.36857 | 66856.04 | Diterpene lactones |
34 | 3-Isobutylglutaric acid | 8.214517 | 16494.50 | Methyl-branched fatty acids |
35 | LPC 18:1 | 15.80038 | 1556111.00 | Lipids |
36 | Phosphatidylcholine lyso 18 | 16.44933 | 19155.42 | 2-acyl-sn-glycero-3-phosphocholines |
37 | Reserpine | 15.13208 | 27432.26 | Yohimbine alkaloids |
38 | ISOPALMITIC ACID | 10.76080 | 133306.00 | Long-chain fatty acids |
39 | Celastrol | 16.38930 | 16379.43 | Triterpenoids |
40 | (4E,8E)-10-(4-hydroxy-6-methoxy-7-methyl-3-oxo-1H-2-benzofuran-5-yl)-4,8-dimethyldeca-4,8-dienoic acid | 15.60355 | 67788.85 | Terpene lactones |
41 | icos-19-ene-1,2,4-triol | 11.94487 | 16965.70 | Long-chain fatty alcohols |
42 | FT-thioether | 7.47550 | 402198.90 | PFSA |
43 | 5-Methoxypsoralen | 1.379833 | 717938.30 | 5-methoxypsoralens |
44 | Chaulmoogric Acid | 13.66750 | 19960.99 | Long-chain fatty acids |
45 | Cinnamoylglycine | 7.752817 | 16160.29 | N-acyl-alpha amino acids |
46 | Griseofulvin | 7.03820 | 19173.55 | Benzofurans |
47 | Ketoisovaleric acid | 1.841267 | 9078.108 | Short-chain keto acids and derivatives |
48 | Glycocholic Acid | 15.75758 | 439946.10 | Glycinated bile acids and derivatives |
49 | Phosphatidylserine 18 | 15.56438 | 30450.24 | Phosphatidylserines |
50 | [(6Z,10Z)-6-(acetyloxymethyl)-10-(hydroperoxymethyl)-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl] 2-methylbutanoate | 9.359233 | 23463.89 | Germacranolides and derivatives |
51 | (2E,4E)-1-[(2R,6S,14S,22S,25R)-25-(3,3-dimethyloxiran-2-yl)-15-methyl-1,3,13,15-tetraazaheptacyclo[18.4.1.0,.0,.0,.0,.0,]pentacosa-7,9,11,16(21),17,19-hexaen-3-yl]hexa-2,4-dien-1-one | 14.41933 | 93651.37 | Alpha carbolines |
52 | 2-[5-[2-[2-[5-(2-hydroxypropyl)oxolan-2-yl]propanoyloxy]propyl]oxolan-2-yl]propanoic acid | 12.90287 | 30013.75 | Dicarboxylic acids and derivatives |
53 | Bufotalin | 15.83517 | 45015.64 | Bufanolides and derivatives |
54 | Furostane base -2H + O-Hex, O-Hex-dHex-dHex-dHex | 9.319567 | 21781.36 | Steroidal saponins |
55 | C18(Plasm)-18:1 PC | 11.90607 | 40133.82 | 1-(1Z-alkenyl),2-acyl-glycerophosphocholines |
56 | DErySphingosine | 10.83890 | 38805.35 | 1,2-aminoalcohols |
57 | C12-AE1S (TENTATIVE) | 12.62238 | 29299.55 | Sulfuric acid monoesters |
58 | LPC 18:3 | 13.62767 | 173150.50 | Lipids |
59 | Nifekalant | 6.64155 | 22225.56 | Phenylpropylamines |
60 | beta-N-Methylaminoalanine | 13.10987 | 30146.63 | Alpha amino acids |
61 | Serine-Cholic Acid | 15.32113 | 551130.30 | Glycinated bile acids and derivatives |
62 | methyl 4-((10R,13R)-3-hydroxy-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-17-yl) pentanoate | 15.44695 | 19387.68 | Monohydroxy bile acids, alcohols, and derivatives |
63 | Diatoxanthin | 7.272067 | 14265.04 | Triterpenoids |
64 | Argatroban | 15.12730 | 47349.21 | Dipeptides |
65 | 9-Methoxy-2,2-dimethyl-2,6-dihydro-pyrano[3,2-c]quinolin-5-one | 1.35255 | 17009.10 | Pyranoquinolines |
66 | Phosphatidylcholine 16 | 7.83215 | 48466.42 | Phosphatidylcholines |
67 | Glutamine | 1.33950 | 40752.10 | Alpha amino acids |
68 | (E)-5-hydroxy-N-[3-[5-[3-[[(E)-5-hydroxy-3-methylpent-2-enoyl]amino]propyl]-3,6-dioxopiperazin-2-yl]propyl]-3-methylpent-2-enamide | 11.65172 | 14764.10 | Alpha amino acids and derivatives |
69 | LPC 16:0 | 14.89577 | 1942964.00 | Lipids |
70 | Shanzhiside methyl ester | 14.03128 | 26912.56 | Iridoid O-glycosides |
71 | 9-Trans-Palmitelaidic acid | 18.88537 | 58417.61 | Long-chain fatty acids |
72 | Sebacic acid | 8.96275 | 28959.26 | Medium-chain fatty acids |
73 | Vindoline | 13.89302 | 60721.01 | Plumeran-type alkaloids |
74 | 9Z,12Z-Linoleic acid (NMR) | 19.25802 | 313966.20 | Lineolic acids and derivatives |
75 | 3-Indoxyl sulfate | 6.68105 | 322077.40 | Arylsulfates |
76 | a-Linolenic acid (NMR) | 18.11325 | 80101.46 | Lineolic acids and derivatives |
77 | Arachidonic acid | 18.92453 | 253179.40 | Long-chain fatty acids |
78 | Taurine | 8.30815 | 5742.452 | Organosulfonic acids |
79 | LPC 18:2 | 14.18563 | 1163369.00 | Lipids |
80 | Oleic acid | 20.54262 | 181184.10 | Long-chain fatty acids |
81 | Conessine | 12.99227 | 21960.55 | Conanine-type alkaloids |
82 | PROTOVERATRINE A | 1.379833 | 21784.06 | Cerveratrum-type alkaloids |
83 | 4-Nitrophenol | 20.19397 | 10567.01 | Nitrophenols |
84 | methyl orsellinate | 1.313333 | 25321.51 | P Hydroxybenzoic acid alkyl esters |
85 | Atalaphylline | 13.38752 | 47479.44 | Acridones |
86 | PFSA-pentafluorosulfide | 1.17735 | 85352.33 | PFSA |
87 | piperazine-2,5-dione | 1.841267 | 12361.39 | Alpha amino acids and derivatives |
88 | N-(4-((6aR,8aS)-4-hydroxy-6a,8a,9-trimethyl-3,4,5,6,6a,6b,7,8,8a,8b,11a,12,12a,12b-tetradecahydro-1H-naphtho[2’,1’:4,5]indeno[2,1-b]furan-10-yl)-2-methylbutyl)acetamide | 15.32113 | 1344867.00 | Furostanes and derivatives |
89 | 6-(furan-3-yl)-6,8,12,16,21-pentahydroxy-7,15-dimethyl-9-oxo-3,17,19-trioxaheptacyclo[9.9.3.0,.0,.0,.0,.0,]tricosan-14-yl 2-methylbutanoate | 13.50750 | 38900.18 | Limonoids |
90 | Gedunol | 15.79632 | 305832.30 | Limonoids |
91 | 2,6-di-tert-butyl-4-methylphenol | 1.70115 | 164993.80 | Phenylpropanes |
92 | 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine | 16.57080 | 1376141.00 | Phosphatidylcholines |
93 | Trifluoroacetic acid | 16.21035 | 175237.70 | PFSA |
94 | Germinaline | 1.379833 | 26898.38 | Alkaloids |
95 | Phytosphingosine (not validated, isomer of 1696) | 10.79983 | 58379.87 | Lipids |
96 | Choline | 15.32113 | 1686757.00 | Cholines |
97 | Decanoic acid | 19.0867 | 11618.62 | Medium-chain fatty acids |
98 | 7-ethenyl-1,4a,7-trimethyl-3,4,6,8,8a,9,10,10a-octahydro-2H-phenanthrene-1-carboxylic acid | 17.87777 | 111714.60 | Diterpenoids |
99 | Uric acid | 1.820983 | 69064.27 | Xanthines |
100 | vanillic acid | 1.313333 | 53861.45 | M-methoxybenzoic acids and derivatives |
101 | Tuberostemonine | 12.69258 | 91277.17 | Stichoneurine-type alkaloids |
102 | (1R,2R,5R,5’S,6S,8aS)-6-(acetyloxy)-2,5,8a-trimethyl-5’’-oxo-octahydro-2H-dispiro[naphthalene-1,2’:5’,3’-bis(oxolane)]-5-ylmethyl acetate | 15.32113 | 668259.40 | Diterpene lactones |
103 | (R)-4-aminoisoxazolidin-3-one | 1.934117 | 30480.44 | Alpha amino acids and derivatives |
104 | (1S,3R,6S,6aR,6bR,8S,9S,11R,11aR,12R,12aR,14R)-1-ethyl-6,8,11-trihydroxy-3-methyl-10-methylenetetradecahydro-3,6a,12-(epiethane[1,1,2]triyl)-9,11a-methanoazuleno[2,1-b]azocine 1-oxide | 12.69258 | 247497.70 | Kaurane diterpenoids |
105 | Secoisolariciresinol | 12.26407 | 15677.30 | Dibenzylbutanediol lignans |
106 | Cyclamate | 6.110917 | 33820.46 | Cyclamates |
107 | Docosahexanoic acid | 18.55157 | 591446.80 | Very long-chain fatty acids |
108 | anthothecol | 14.03128 | 23028.57 | Limonoids |
109 | (1R,4aR,5S)-5-(3-hydroxy-3-methylpent-4-enyl)-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | 15.60355 | 517448.60 | Diterpenoids |
110 | (6aR,8aS)-11-(3-acetamido-2-methylpropyl)-6a,8a,9-trimethyl-10-oxo-1,3,4,5,6,6a,6b,7,8,8a,8b,9,10,12,12a,12b-hexadecahydropentaleno[2,1-a]phenanthren-4-yl acetate | 14.89468 | 53006.64 | Steroid esters |
111 | 4-((9S)-3,5,14-trihydroxy-10-((E)-((1-hydroxybutan-2-yl)imino)methyl)-13-methylhexadecahydro-1H-cyclopenta[a]phenanthren-17-yl)furan-2(5H)-one | 13.89302 | 42323.20 | Cardenolides and derivatives |
112 | N-ACETYL-L-LEUCINE | 7.51500 | 24397.29 | Leucine and derivatives |
113 | 2-Mercaptobenzothiazole | 17.58292 | 35381.59 | Benzothiazoles |
114 | Pristimerin | 17.16623 | 48255.61 | Triterpenoids |
- Citation: Wu JJ, Zhang SY, Mu L, Dong ZG, Zhang YJ. Heyingwuzi formulation alleviates diabetic retinopathy by promoting mitophagy via the HIF-1α/BNIP3/NIX axis. World J Diabetes 2024; 15(6): 1317-1339
- URL: https://www.wjgnet.com/1948-9358/full/v15/i6/1317.htm
- DOI: https://dx.doi.org/10.4239/wjd.v15.i6.1317