©The Author(s) 2020.
World J Diabetes. Dec 15, 2020; 11(12): 567-571
Published online Dec 15, 2020. doi: 10.4239/wjd.v11.i12.567
Published online Dec 15, 2020. doi: 10.4239/wjd.v11.i12.567
Table 1 Represents the characteristics of mature miR- 802-5p
| Source miRNA | Source organism | PL | MFE ∆ G | MS | Strand | A + U, % |
| hsa-miR-802 | Homo sapiens | 94 | -22.90 | CAGUAACAAAGAUUCAUCCUUGU | 3’ | 70 |
Table 2 Represents the targets of hsa-miR-802-5p based on target scan analysis
| SI. No. | Target gene | Representative transcript | Gene name | Representative miRNA |
| 1 | TMED9 | ENST00000332598.6 | Transmembrane emp24 transport domain containing 9 | hsa-miR-802 |
| 2 | PCNP | ENST00000296024.5 | PEST proteolytic signal containing nuclear protein | hsa-miR-802 |
| 3 | C3orf58 | ENST00000441925.2 | Chromosome 3 open reading frame 58 | hsa-miR-802 |
| 4 | NUS1 | ENST00000368494.3 | Nuclear undecaprenyl pyrophosphate synthase 1 homolog | hsa-miR-802 |
| 5 | ZNF597 | ENST00000301744.4 | Zinc finger protein 597 | hsa-miR-802 |
- Citation: Rajkumar KV, Lakshmanan G, Sekar D. Identification of miR-802-5p and its involvement in type 2 diabetes mellitus. World J Diabetes 2020; 11(12): 567-571
- URL: https://www.wjgnet.com/1948-9358/full/v11/i12/567.htm
- DOI: https://dx.doi.org/10.4239/wjd.v11.i12.567
