BPG is committed to discovery and dissemination of knowledge
Field of Vision
©The Author(s) 2020.
World J Diabetes. Dec 15, 2020; 11(12): 567-571
Published online Dec 15, 2020. doi: 10.4239/wjd.v11.i12.567
Table 1 Represents the characteristics of mature miR- 802-5p
Source miRNASource organismPLMFE ∆ GMSStrandA + U, %
hsa-miR-802Homo sapiens94-22.90CAGUAACAAAGAUUCAUCCUUGU3’70
Table 2 Represents the targets of hsa-miR-802-5p based on target scan analysis
SI. No.
Target gene
Representative transcript
Gene name
Representative miRNA
1TMED9ENST00000332598.6Transmembrane emp24 transport domain containing 9hsa-miR-802
2PCNPENST00000296024.5PEST proteolytic signal containing nuclear proteinhsa-miR-802
3C3orf58ENST00000441925.2Chromosome 3 open reading frame 58hsa-miR-802
4NUS1ENST00000368494.3Nuclear undecaprenyl pyrophosphate synthase 1 homologhsa-miR-802
5ZNF597ENST00000301744.4Zinc finger protein 597hsa-miR-802