Published online Sep 15, 2026. doi: 10.4239/wjd.123886
Revised: July 17, 2026
Accepted: August 25, 2026
Published online: September 15, 2026
Processing time: 96 Days and 5.6 Hours
Diabetic kidney disease (DKD) is one of the most severe microvascular complications of diabetes, characterized by pathological changes such as glomerulosclerosis and renal interstitial fibrosis. Recent studies indicate that abnormal renal lipid metabolism and lipotoxicity are key drivers of DKD progression, where dysfunctional coupling between lipid droplets and mitochondria leads to in
To investigate the protective effect of ginsenoside Rd against DKD and its under
Db/db mouse DKD model was used and treated with different doses of ginsenoside Rd. Renal function and lipid levels were assessed biochemically; fibrosis was evaluated via histochemical staining; lipid droplet-mitochondria interaction was examined by electron microscopy and immunofluorescence. Using Plin1 deficient models, we examined the Plin1/Mfn2 signaling pathway and related molecules by polymerase chain reaction and western blotting.
Ginsenoside Rd significantly improved glycemic control, renal function, and attenuated renal fibrosis in db/db mice. This was associated with reduced renal lipid deposition and enhanced FA oxidation. Further studies showed that ginsenoside Rd promoted lipid droplet-mitochondria contact and activated the Plin1/Mfn2 pathway. These protective effects were abolished in Plin1 knockout or knockdown models.
This study demonstrates that ginsenoside Rd alleviates DKD by activating protein kinase A, which enhances Plin1/Mfn2-mediated lipid droplet-mitochondria contact, thereby accelerating FA oxidation, reducing lipotoxicity and renal fibrosis.
Core Tip: This study identifies the protein kinase A/perilipin (Plin) 1/mitofusin 2 axis as a novel therapeutic target for diabetic kidney disease. Ginsenoside Rd activates protein kinase A, promotes Plin1-mitofusin 2 interaction, enhances lipid droplet-mitochondria contact, and stimulates fatty acid oxidation, thereby attenuating renal lipid accumulation and fibrosis. Using in vivo and in vitro lossoffunction models, we demonstrate that Plin1 is essential for ginsenoside Rd induced organelle tethering and metabolic benefit, providing a mechanistic framework for diabetic kidney disease intervention.
- Citation: Wu WB, Tao Y, Xu NJ, Shao QQ, Yuan F, Dong H, Lu FE, Zheng CH, Wu F. Ginsenoside Rd promote the contact between mitochondria and lipid droplets through Plin1/Mfn2 to treat diabetic kidney disease. World J Diabetes 2026; 17(9): 123886
- URL: https://www.wjgnet.com/1948-9358/full/v17/i9/123886.htm
- DOI: https://dx.doi.org/10.4239/wjd.123886
Epidemiological studies have indicated that there were 537 million individuals with diabetes in 2023, and this is projected to increase to 643 million by 2030[1]. Concurrently, diabetic kidney disease (DKD), one of the most severe and common complications, has been rising in prevalence. It is estimated that up to 40% of diabetic patients will ultimately develop DKD[2,3]. A hallmark of DKD progression is renal interstitial fibrosis; a pathological process driven by fibroblast acti
Intrarenal lipid deposition, particularly within renal tubular epithelial cells, is recognized as a key contributor to the pathogenesis of renal interstitial fibrosis in DKD[10-12]. This ectopic lipid accumulation can affect tubular cells, podo
Cellular lipids are primarily stored in cytoplasmic organelles known as lipid droplets. Under physiological conditions, a close physical interaction between droplets and mitochondria facilitates lipid metabolism[17,18]. TGs are hydrolyzed by lipases to release FFAs, which are then transported into mitochondria for beta-oxidation, which generates energy[19,20]. This organelle contact is thus a fundamental biological mechanism for efficient fatty acid (FA) oxidation, and its enhance
Perilipin (Plin) 1 is one of the most classical direct target genes of the peroxisome proliferator-activated receptor (PPAR) signaling pathway. It localizes to the surface of lipid droplets, belongs to the perilipin protein family, and serves as a key mediator of the contact between lipid droplets and mitochondria[21,22]. Research has identified mitofusin (Mfn) 2, a protein located in the mitochondrial outer membrane, as a direct binding partner for Plin1. Upregulation of Plin1 and Mfn2 expression enhances FA oxidation capacity. Protein kinase (PK) A-mediated phosphorylation of Plin1 has been shown to strengthen its interaction with Mfn2, facilitating the tethering between lipid droplets and mitochondria[23].
Ginsenoside Rd, a principal bioactive compound derived from Panax ginseng Meyer, constitutes approximately 6.6% of the total ginsenoside content[24,25]. This compound has demonstrated hypoglycemic properties; treatment with ginseno
By integrating in vitro and in vivo experimental approaches, we demonstrated that ginsenoside Rd attenuated renal interstitial fibrosis in DKD. We identified that this renoprotective effect was mediated through promotion of FA oxida
Fibronectin antibody (ab269020), collagen I antibody (ab270993), α-smooth muscle actin (SMA) antibody (ab124964), Plin1 antibody (ab172907), and Mfn2 antibody (ab205236) were purchased from Abcam (Cambridge, United Kingdom); p-PKA antibody (D45D3) and t-PKA antibody (D38C6) were from Cell Signaling Technology (Beverly, MA, United States). Assay kits for TG (A110-1-1) and creatinine (C011-2-1) were obtained from Jiancheng Bioengineering Institute (Nanjing, Jiangsu Province, China); kits for albumin (MU30662) and FFA (BTK025) bought from Bioswamp (Wuhan, Hubei Province, China). Other routine reagents were supplied by Servicebio Technology (Wuhan, Hubei Province, China).
Twelve-week-old male db/m and db/db mice were obtained from Shulaibao Biotechnology Co. Ltd. (Nanjing, Jiangsu Province, China). The db/m mice served as the control group, while db/db mice were allocated into four experimental groups (n = 6 per group) by means of a random number table: (1) Model (10 mg/kg ginsenoside Rd); (2) Low (10 mg/kg ginsenoside Rd); (3) High (20 mg/kg ginsenoside Rd); and (4) Finerenone (10 mg/kg finerenone). The treatment groups received daily oral administration of ginsenoside Rd and finerenone for 6 weeks, while the control and model groups received equivalent volumes of distilled water. Seven-week-old male Plin1+/+ and Plin1-/- mice (C57BL/6 background, global knockout, backcrossed for ≥ 6 generations, n = 6 per group) were obtained from Shulaibao Biotechnology. The db/db mouse model was validated by measuring nonfasting blood glucose and body weight, confirming the diabetic phenotype. Plin1 deficiency was confirmed by PCR and Western blot analysis of Plin1 protein expression in adipose and renal tissues. After 4 weeks on a high-fat diet, mice were given intraperitoneal streptozotocin (40 mg/kg in 0.1 M sodium citrate buffer, pH 4.5) after overnight fasting for 5 consecutive days. Diabetes was confirmed 1 week post-injection, after which Plin1-/Plin1- mice received daily gavage of 20 mg/kg ginsenoside Rd for 6 weeks. For Glucose Tolerance Test (GTT) and Insulin Tolerance Test (ITT), mice were fasted for 12 hours and 6 hours, respectively. Blood glucose was measured at 0 minute, 15 minutes, 30 minutes, 60 minutes, 90 minutes, and 120 minutes after intraperitoneal injection of glucose (2 g/kg) or insulin (0.75 U/kg). Area under the curve (AUC) was calculated using the trapezoidal rule (incremen
Paraffin-embedded tissue sections were first deparaffinized in xylene and rehydrated through a graded ethanol series. To quench endogenous peroxidase activity, the sections were heated in antigen retrieval solution at 95 °C for 15 minutes using a water bath. Following blocking with 20% normal goat serum for 1 hour, the sections were sequentially incubated with primary antibodies (1:200) overnight at 4 °C and with secondary antibodies (1:500) for 1 hour at 37 °C. Finally, the stained sections were coverslipped and imaged using a bright-field microscope. For quantitative colocalization analysis, fluorescence images were acquired and processed using ImageJ software. The Pearson's correlation coefficient was calculated using the JACoP plugin of ImageJ, which evaluates the pixelbypixel correlation between the fluorescence intensities of the two channels across the entire region of interest.
For transmission electron microscopy, renal tissue specimens measuring approximately 1 mm³ were immediately fixed in 2.5% glutaraldehyde solution. Following primary fixation, the samples were subsequently embedded in liquid epoxy resin. Grids bearing the ultra-thin sections (50-100 nm) were processed for sequential staining with uranyl acetate and lead citrate.
HK-2 cells were utilized to investigate the effects of ginsenoside Rd on renal cells under diabetic conditions. Cells were routinely maintained in high-glucose Dulbecco’s modified Eagle’s medium with 15% fetal bovine serum. To establish an in vitro type 2 diabetes mellitus model, palmitic acid (PA) was added to the culture medium. Subsequently, ginsenoside Rd was introduced as a therapeutic intervention. For genetic manipulation, cells were transfected with either negative control siRNA or one of three specific Plin1-targeting siRNAs (si-Plin1-1, si-Plin1-2, and si-Plin1-3) to downregulate Plin1 expression. Transfection was performed by applying 50 nM siRNA (diluted in the provided diluent) to cells for 6 hours. The knockdown efficiency was validated at transcriptional and translational levels using quantitative polymerase chain reaction (PCR) and western blotting. The corresponding siRNA sequences are provided in Table 1. Optimal working concentrations of PA and ginsenoside Rd were determined through CCK-8 viability assays. Following 24-hour treatment periods, both cellular extracts and conditioned media were collected for subsequent experimental analyses.
| siRNA | Forward (5’-3’) | Reverse (5’-3’) |
| siPlin1-1 | GAACAAGUUCAGUGAGGUATT | UACCUCACUGAACUUGUUCTT |
| siPlin1-2 | AGACCUACACCAGCACUAATT | UUAGUGCUGGUGUAGGUCUTT |
| siPlin1-3 | GGAUCAUGAGGACCAGACATT | UGUCUGGUCCUCAUGAUCCTT |
Mice from the Model and High groups were killed and their kidneys were collected. Total RNA was extracted using TRIzol and subjected to library construction with the NEBNext® Ultra™ RNA Library Prep Kit (New England Biolabs, Ipswich, MA, United States). Sequencing was performed on an Illumina NovaSeq 6000 platform (paired-end 150 bp). Raw reads were trimmed with Trimmomatic and aligned to the reference genome using HISAT2. Gene counts were obtained with featureCounts. Differentially expressed genes were identified using DESeq2 with thresholds of |log2FC| ≥ 1 and Padj < 0.05. We conducted Kyoto Encyclopedia of Genes and Genomes annotation analyses of common differentially ex
For co-immunoprecipitation (Co-IP), HK-2 cells were lysed in IP lysis buffer supplemented with protease and phospha
Protein extracts were separated by electrophoresis using a two-step voltage protocol (80V, 30 minutes, and then 120V, 60 minutes) and subsequently transferred onto PVDF membranes at a constant current of 280 mA, with the transfer time adjusted according to protein molecular weight. The membranes were blocked with sealing solution. At 4 °C, the membranes were incubated with specific primary antibodies (1:1000) for 12 hours. Secondary antibodies (1:10000) were given to react for 1 hour and subjected to exposure and photography. The original data are available in Supplementary material.
The purified RNA was subsequently reverse-transcribed into cDNA using a commercial reverse transcription kit. For quantitative PCR analysis, the reaction mixture containing SYBR Mix, primers, and cDNA was prepared according to the established protocol. The sequences of all primers used in this study are provided in Table 2.
| Gene | Forward (5’-3’) | Reverse (5’-3’) |
| HADHB | GCCAAGAAGGCACAGGATG | AGGGTTTGATGAACGCAGGT |
| MCAD | AGAAGTATTTGGGGAGGATGACG | CCGTTGGTTATCCACATCTTCTG |
| Plin1 | GGTGAGCGGGACCTGTGA | TTCTCATAGGCATTGCACACAGA |
| Mfn2 | ATACATCACCTTAAATACATCAG | TTAAATTTATACCACTGAGGG |
| GAPDH | CCTCGTCCCGTAGACAAAATG | TGAGGTCAATGAAGGGGTCGT |
Sample sizes were determined based on our preliminary experiments and previously published studies using the db/db mouse model. Based on an expected difference of 30% in the primary outcome (blood glucose or AUC of GTT) with a standard deviation of approximately 20%, a power of 80% and a two-sided significance level of α = 0.05, the required sample size was calculated as n = 6 per group using GPower software (version 3.1). This calculation is consistent with the sample sizes commonly used in similar DKD studies. All statistical analyses were conducted using GraphPad Prism 8.0.1. Statistical comparisons were performed using one-way or two-way analysis of variance with Tukey’s post hoc test for parametric data, or the Kruskal-Wallis test for nonparametric data, as determined by the Shapiro-Wilk normality test. All data are presented as mean ± SEM, with P < 0.05 considered statistically significant.
To evaluate the therapeutic potential of ginsenoside Rd, we used db/db mice as an experimental model (Figure 2A). Weights were assessed at weekly intervals for the study duration (Figure 2B), and terminal body weight was recorded prior to death (Figure 2C). Fasting blood glucose levels were measured on a weekly basis to track glycemic control (Figure 2D). We performed GTT and ITT to assess systemic glucose homeostasis and insulin sensitivity (Figure 2E and F). Ginsenoside Rd significantly improved glucose tolerance and insulin sensitivity, as indicated by a reduction in the AUC (Figure 2G and H). Serum creatinine levels were quantified by ELISA (Figure 2I). Diabetic db/db mice exhibited impaired renal function, characterized by decreased creatinine clearance rate (CCR) and an elevated urinary albumin-to-creatinine ratio (UACR), which were both significantly reversed by ginsenoside Rd (Figure 2J and K). Finerenone, used as a positive control, significantly improved renal function. The renoprotective effects of ginsenoside Rd were similar to those of finerenone, confirming the therapeutic potential of Rd against DKD.
Histopathological evaluation of renal tissues was performed using hematoxylin and eosin, Masson, and periodic acid-Schiff staining (Figure 3A-C). Immunohistochemical staining revealed increased positive areas of fibronectin, collagen I, and α-SMA in the model group, which was markedly attenuated following ginsenoside Rd administration (Figure 3D-I). Western blotting confirmed upregulation of these fibrotic proteins in diabetic mice, and likewise demonstrated their suppression after ginsenoside Rd treatment (Figure 3J-M).
Ginsenoside Rd significantly reduced renal TG and FFA in the Low and High groups (Figure 4A and B). Consistent with enhanced lipid catabolism, the mRNA expression of hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit beta (HADHB), carnitine O-octanoyltransferase (CROT), and medium-chain acyl-CoA dehydrogenase (MCAD) was significantly upregulated in ginsenoside Rd-treated groups (Figure 4C-E). Ultrastructural analysis revealed enhanced lipid droplet-mitochondria contact in renal tubular epithelial cells of treated mice (Figure 4F), which was corroborated by immunofluorescence colocalization showing significantly higher Pearson’s correlation coefficients (Figure 4G and H). We used transcriptomics to detect the main DEGs in the kidneys of mice. There were 164 DEGs, among which those related to lipid droplet metabolism were mainly enriched in the PPAR signaling pathway (Figure 4I). We tested common downstream genes of PPARs, and found that expression of Plin1 showed significant differences. At the molecular level, ginsenoside Rd treatment increased the mRNA of Plin1 and Mfn2 (Figure 4J and K). Western blotting confirmed the upregulation of these proteins and showed enhanced phosphorylation of PKA in the treatment groups (Figure 4L). Densitometric quantification revealed that the levels of phosphorylated PKA, along with total Plin1 and Mfn2 protein expression, were significantly elevated following ginsenoside Rd administration (Figure 4M-O).
Body weight was monitored weekly in Plin1+/Plin1- and Plin1-/Plin1- mice (Figure 5A and B), with terminal weights recorded prior to death (Figure 5C). Fasting blood glucose levels were tracked on a weekly basis (Figure 5D). GTT and ITT were performed (Figure 5E and F), and the corresponding AUCs were calculated (Figure 5G and H). Renal function assessment demonstrated elevated serum creatinine, reduced CCR, and increased UACR in Plin1-/Plin1- mice compared with Plin1+/Plin1- controls (Figure 5I-K).
Histological analysis of kidney tissue using hematoxylin and eosin, Masson, and periodic acid-Schiff staining revealed more severe structural alterations in Plin1-/Plin1- mice (Figure 6A-C). Immunohistochemical staining for fibrotic markers showed expanded positive areas of fibronectin, collagen I, and α-SMA in Plin1-/Plin1- kidneys (Figure 6D-I). Western blotting confirmed the upregulation of these fibrosis-related proteins in Plin1-/Plin1- mice relative to Plin1+/Plin1- controls (Figure 6J-M).
Plin1-/Plin1- mice exhibited significantly elevated serum levels of TGs and FFAs (Figure 7A and B), accompanied by marked downregulation in mRNA expression of FA β-oxidation enzymes HADHB, CROT, and MCAD (Figure 7C-E). Transmission electron microscopy revealed reduced lipid droplet-mitochondria contact in Plin1-/Plin1- kidneys (Figure 7F), which was corroborated by immunofluorescence colocalization studies (Figure 7G and H). The mRNA and protein expression analyses confirmed significant suppression of key components in the Plin1/Mfn2 signaling pathway, including reduced PKA phosphorylation and decreased Plin1 and Mfn2 levels in Plin1-/Plin1- mice (Figure 7I-N).
HK-2 cell viability was significantly reduced by 0.2 mmol/L PA and 40 μmol/L ginsenoside Rd (Figure 8A-C). Knockdown efficiency of siPlin1 was evaluated by PCR and western blotting, revealing that si-Plin1-2 achieved > 70% suppression at both transcriptional and protein levels (Figure 8D-F). Co-IP assays further revealed that ginsenoside Rd treatment markedly enhanced the physical interaction between Plin1 and Mfn2 in HK-2 cells (Figure 8G).
Ginsenoside Rd significantly downregulated expression of fibrotic markers (fibronectin, collagen I, and α-SMA) in HK-2 cells, which was abolished upon Plin1 knockout (Figure 9A-D). Concurrently, ginsenoside Rd reduced extracellular levels of TGs and FFAs in the culture medium (Figure 9E and F) and enhanced mRNA expression of FA β-oxidation enzymes HADHB, CROT, and MCAD (Figure 9G-I). At the molecular level, ginsenoside Rd promoted mRNA (Figure 9J and K) and protein expression of Plin1 and Mfn2, along with increased PKA phosphorylation (Figure 9L-O). All these effects were abolished in Plin1 knockout cells, confirming the essential role of Plin1 in mediating the lipid-metabolic and anti
P. ginseng holds a well-established position within traditional medicine, with key therapeutic applications in addressing metabolic disorders and their complications[29,30]. Our investigation focused on ginsenoside Rd; a bioactive component derived from this medicinal plant. We built a model of diabetes nephropathy in db/db mice. Ginsenoside Rd significantly lowered fasting blood glucose level and improved overall glucose tolerance, as demonstrated by reduced AUC in both GTT and ITT. These metabolic improvements were accompanied by preserved renal function, reflected by maintained CCR and reduced UACR levels. These metabolic benefits were accompanied by marked preservation of renal architecture and function, suggesting the potential of ginsenoside Rd in counteracting the progression of DKD.
Histopathological evaluation through multiple staining techniques provided compelling evidence that ginsenoside Rd attenuated the development of renal interstitial fibrosis in diabetic mice. This antifibrotic effect was substantiated at the molecular level through comprehensive analyses showing significant downregulation of extracellular matrix components including fibronectin, collagen I, and α-SMA following treatment with ginsenoside Rd.
Considering the well-documented role of ectopic lipid deposition in promoting renal injury, we systematically investigated the lipid-modulating properties of ginsenoside Rd. Our metabolic analyses revealed that treatment significantly reduced circulating levels of TG and FFA while simultaneously upregulating the expression of key enzymes involved in FA β-oxidation. To elucidate the mechanistic basis for these improvements, we examined the critical interaction between lipid droplets and mitochondria. Advanced microscopic techniques demonstrated that ginsenoside Rd markedly en
Among the significantly enriched pathways, we prioritized the PPAR signaling pathway because it was the most prominent for lipid-droplet-related genes, whereas other hits (e.g., nuclear factor-κB and tumor necrosis factor) are primarily inflammationassociated and less relevant to the contact between mitochondria and lipid droplets. We examined the expression of common PPAR downstream genes involved in this process, such as Plin1, Plin4, and Plin5, and found that Plin1 showed the most significant changes. Further molecular characterization identified that ginsenoside Rd exerts its effects through activation of the Plin1/Mfn2 signaling axis. This activation manifests through enhanced expression of proteins and promotion of their functional interaction via PKA-mediated phosphorylation events. The significance of this pathway was unequivocally established through rigorous genetic approaches, where ablation of Plin1 completely abolished the therapeutic benefits of ginsenoside Rd on metabolic parameters, renal function, and fibrotic processes. The essential nature of Plin1 was highlighted by the persistence of lipid droplet-mitochondria dysregulation, suppressed FA oxidation capacity, and accumulated renal lipids despite ginsenoside Rd intervention in knockout models. Complementary cellular studies provided additional validation of these findings. Using optimized experimental conditions established through viability assays and efficient gene silencing approaches, we confirmed that ginsenoside Rd upregulated the Plin1/Mfn2 pathway, enhanced FA oxidative capacity, and reduced fibrotic protein expression in renal tubular cells. The complete reversal of these protective effects upon Plin1 knockdown provides compelling evidence for the indispensability of this pathway in mediating the therapeutic actions of ginsenoside Rd. Furthermore, Co-IP assays in HK-2 cells confirmed a physical interaction between Plin1 and Mfn2, supporting the notion that Plin1 may directly recruit Mfn2 to the lipid droplet surface, thereby facilitating mitochondria-lipid droplet contacts.
Given that Plin1 is highly expressed in adipose tissue and serves as a key regulator of lipolysis, the observed renoprotection in Plin1-/- mice may be attributed, at least in part, to systemic metabolic improvements rather than exclusively to local renal effects. Future studies using kidney specific conditional Plin1 knockout micewill be necessary to definitively dissect the cell autonomous vs systemic contributions of Plin1 deficiency to DKD protection. Nonetheless, our complementary in vitro experiments using Plin1 knockdown cells provide direct evidence that Plin1 deficiency in renal tubular cells per se enhances lipid droplet mitochondria contact and FA oxidation, supporting a local renoprotective mechanism.
We also acknowledge that the sample sizes in our molecular assays are relatively small, which may limit the statistical power to detect smaller effect sizes. Nevertheless, the consistent and statistically significant differences observed across multiple independent experiments, together with the validation in both in vivo and in vitro models, support the robustness of our conclusions. Another limitation of this study is that all animal experiments were performed exclusively in male mice. Given that estrogen is known to influence lipid metabolism, mitochondrial function, and susceptibility to diabetic complications, the protective effects of ginsenoside Rd observed in male mice may not be directly generalizable to females. While our Plin1 knockout data suggest that Plin1/Mfn2 mediated mitochondria and lipid droplet interaction is required for the renoprotective effects of ginsenoside Rd, causal evidence remains incomplete. Future studies employing Plin1 overexpression or Mfn2 reconstitution in Plin1-deficient mice would be necessary to definitively establish the sufficiency of this pathway.
Ginsenoside Rd directly attenuates renal fibrosis and improves renal function by promoting the degradation of lipids deposited in the kidney. Meanwhile, ginsenoside Rd also exerts an indirect renoprotective effect through its beneficial regulation of systemic glucose and lipid metabolism. Our comprehensive investigation establishes that ginsenoside Rd alleviates DKD through a coordinated mechanism involving PKA-mediated activation of the Plin1/Mfn2 signaling pathway, which facilitates enhanced lipid droplet-mitochondria interaction, promotes FA oxidation, reduces lipid accumulation, and ultimately attenuates renal fibrosis while preserving renal function. However, we acknowledge the limitations of this study, including the small sample sizes and the use of maleonly mice, which may affect the generalizability of our conclusions. Further studies incorporating both sexes and larger cohorts are needed to confirm these findings.
For decades, P. ginseng has been extensively used in traditional medicine for the management of DKD. In this study, we investigated the therapeutic potential of its principal active constituent, ginsenoside Rd, and demonstrated its efficacy in ameliorating DKD. Our results revealed that ginsenoside Rd significantly attenuates renal interstitial fibrosis and enhances FA oxidation in renal tissues of db/db mice. Ultrastructural analysis confirmed that ginsenoside Rd promotes contact between lipid droplets and mitochondria. Through genetic knockdown of Plin1 in both murine models and cultured cells, we established that ginsenoside Rd facilitates lipid droplet-mitochondria interaction via activation of the Plin1/Mfn2 signaling pathway. These findings provide novel insights into the molecular basis of the renoprotective effects of ginsenoside Rd and highlight the therapeutic potential of targeting organelle interactions in metabolic kidney diseases. The study bridges traditional medicinal application with modern mechanistic understanding, offering new perspectives for developing targeted interventions for DKD management.
| 1. | Sun H, Saeedi P, Karuranga S, Pinkepank M, Ogurtsova K, Duncan BB, Stein C, Basit A, Chan JCN, Mbanya JC, Pavkov ME, Ramachandaran A, Wild SH, James S, Herman WH, Zhang P, Bommer C, Kuo S, Boyko EJ, Magliano DJ. IDF Diabetes Atlas: Global, regional and country-level diabetes prevalence estimates for 2021 and projections for 2045. Diabetes Res Clin Pract. 2022;183:109119. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 8030] [Cited by in RCA: 6679] [Article Influence: 1669.8] [Reference Citation Analysis (15)] |
| 2. | Anders HJ, Huber TB, Isermann B, Schiffer M. CKD in diabetes: diabetic kidney disease versus nondiabetic kidney disease. Nat Rev Nephrol. 2018;14:361-377. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 669] [Cited by in RCA: 593] [Article Influence: 74.1] [Reference Citation Analysis (6)] |
| 3. | Wu H, Gonzalez Villalobos R, Yao X, Reilly D, Chen T, Rankin M, Myshkin E, Breyer MD, Humphreys BD. Mapping the single-cell transcriptomic response of murine diabetic kidney disease to therapies. Cell Metab. 2022;34:1064-1078.e6. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 23] [Cited by in RCA: 209] [Article Influence: 52.3] [Reference Citation Analysis (0)] |
| 4. | Reidy K, Kang HM, Hostetter T, Susztak K. Molecular mechanisms of diabetic kidney disease. J Clin Invest. 2014;124:2333-2340. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 777] [Cited by in RCA: 731] [Article Influence: 60.9] [Reference Citation Analysis (7)] |
| 5. | Fu J, Sun Z, Wang X, Zhang T, Yuan W, Salem F, Yu SM, Zhang W, Lee K, He JC. The single-cell landscape of kidney immune cells reveals transcriptional heterogeneity in early diabetic kidney disease. Kidney Int. 2022;102:1291-1304. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 13] [Cited by in RCA: 119] [Article Influence: 29.8] [Reference Citation Analysis (0)] |
| 6. | Młynarska E, Buławska D, Czarnik W, Hajdys J, Majchrowicz G, Prusinowski F, Stabrawa M, Rysz J, Franczyk B. Novel Insights into Diabetic Kidney Disease. Int J Mol Sci. 2024;25:10222. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 77] [Reference Citation Analysis (1)] |
| 7. | Deng X, Tang C, Fang T, Li T, Li X, Liu Y, Zhang X, Sun B, Sun H, Chen L. Disruption of branched-chain amino acid homeostasis promotes the progression of DKD via enhancing inflammation and fibrosis-associated epithelial-mesenchymal transition. Metabolism. 2025;162:156037. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 32] [Cited by in RCA: 38] [Article Influence: 38.0] [Reference Citation Analysis (0)] |
| 8. | Shahzad K, Fatima S, Khawaja H, Elwakiel A, Gadi I, Ambreen S, Zimmermann S, Mertens PR, Biemann R, Isermann B. Podocyte-specific Nlrp3 inflammasome activation promotes diabetic kidney disease. Kidney Int. 2022;102:766-779. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 129] [Cited by in RCA: 133] [Article Influence: 33.3] [Reference Citation Analysis (2)] |
| 9. | Lv Z, Hu J, Su H, Yu Q, Lang Y, Yang M, Fan X, Liu Y, Liu B, Zhao Y, Wang C, Lu S, Shen N, Wang R. TRAIL induces podocyte PANoptosis via death receptor 5 in diabetic kidney disease. Kidney Int. 2025;107:317-331. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 60] [Reference Citation Analysis (1)] |
| 10. | Han YZ, Du BX, Zhu XY, Wang YZ, Zheng HJ, Liu WJ. Lipid metabolism disorder in diabetic kidney disease. Front Endocrinol (Lausanne). 2024;15:1336402. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 50] [Cited by in RCA: 48] [Article Influence: 24.0] [Reference Citation Analysis (0)] |
| 11. | Zuo F, Wang Y, Xu X, Ding R, Tang W, Sun Y, Wang X, Zhang Y, Wu J, Xie Y, Liu M, Wang Z, Yi F. CCDC92 deficiency ameliorates podocyte lipotoxicity in diabetic kidney disease. Metabolism. 2024;150:155724. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 30] [Cited by in RCA: 32] [Article Influence: 16.0] [Reference Citation Analysis (0)] |
| 12. | Wang Y, Liu T, Wu Y, Wang L, Ding S, Hou B, Zhao H, Liu W, Li P. Lipid homeostasis in diabetic kidney disease. Int J Biol Sci. 2024;20:3710-3724. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 57] [Cited by in RCA: 52] [Article Influence: 26.0] [Reference Citation Analysis (0)] |
| 13. | Ji C, Zhang J, Shi H, Chen B, Xu W, Jin J, Qian H. Single-cell RNA transcriptomic reveal the mechanism of MSC derived small extracellular vesicles against DKD fibrosis. J Nanobiotechnology. 2024;22:339. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 21] [Cited by in RCA: 28] [Article Influence: 14.0] [Reference Citation Analysis (1)] |
| 14. | Zaky A, Glastras SJ, Wong MYW, Pollock CA, Saad S. The Role of the Gut Microbiome in Diabetes and Obesity-Related Kidney Disease. Int J Mol Sci. 2021;22:9641. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 56] [Cited by in RCA: 134] [Article Influence: 26.8] [Reference Citation Analysis (1)] |
| 15. | Zhao Y, Fan S, Zhu H, Zhao Q, Fang Z, Xu D, Lin W, Lin L, Hu X, Wu G, Min J, Liang G. Podocyte OTUD5 alleviates diabetic kidney disease through deubiquitinating TAK1 and reducing podocyte inflammation and injury. Nat Commun. 2024;15:5441. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 47] [Reference Citation Analysis (0)] |
| 16. | Ye S, Zhang M, Zheng X, Li S, Fan Y, Wang Y, Peng H, Chen S, Yang J, Tan L, Zhang M, Xie P, Li X, Luo N, Wang Z, Jin L, Wu X, Pan Y, Fan J, Zhou Y, Tang SCW, Li B, Chen W. YAP1 preserves tubular mitochondrial quality control to mitigate diabetic kidney disease. Redox Biol. 2024;78:103435. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1] [Cited by in RCA: 23] [Article Influence: 11.5] [Reference Citation Analysis (0)] |
| 17. | Li Q, Zhao Y, Guo H, Li Q, Yan C, Li Y, He S, Wang N, Wang Q. Impaired lipophagy induced-microglial lipid droplets accumulation contributes to the buildup of TREM1 in diabetes-associated cognitive impairment. Autophagy. 2023;19:2639-2656. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 1] [Cited by in RCA: 179] [Article Influence: 59.7] [Reference Citation Analysis (0)] |
| 18. | Klemm RW, Carvalho P. Lipid Droplets Big and Small: Basic Mechanisms That Make Them All. Annu Rev Cell Dev Biol. 2024;40:143-168. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 12] [Cited by in RCA: 41] [Article Influence: 20.5] [Reference Citation Analysis (0)] |
| 19. | Farese RV, Walther TC. Essential Biology of Lipid Droplets. Annu Rev Biochem. 2025;94:447-477. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 32] [Cited by in RCA: 23] [Article Influence: 23.0] [Reference Citation Analysis (0)] |
| 20. | Kumar V, Xin X, Ma J, Tan C, Osna N, Mahato RI. Therapeutic targets, novel drugs, and delivery systems for diabetes associated NAFLD and liver fibrosis. Adv Drug Deliv Rev. 2021;176:113888. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 142] [Cited by in RCA: 139] [Article Influence: 27.8] [Reference Citation Analysis (1)] |
| 21. | Luo K, Zhuang K, Wu H, Chen Y, Liu Y, Yang F, Wang Z. PLIN1 suppresses glioma progression through regulating lipid metabolism. Cell Death Dis. 2025;16:48. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 4] [Reference Citation Analysis (0)] |
| 22. | Afonso MB, Islam T, Magusto J, Amorim R, Lenoir V, Simões RF, Teixeira J, Silva LC, Wendum D, Jéru I, Vigouroux C, Castro RE, Oliveira PJ, Prip-Buus C, Ratziu V, Gautheron J, Rodrigues CMP. RIPK3 dampens mitochondrial bioenergetics and lipid droplet dynamics in metabolic liver disease. Hepatology. 2023;77:1319-1334. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 7] [Cited by in RCA: 42] [Article Influence: 14.0] [Reference Citation Analysis (0)] |
| 23. | Boutant M, Kulkarni SS, Joffraud M, Ratajczak J, Valera-Alberni M, Combe R, Zorzano A, Cantó C. Mfn2 is critical for brown adipose tissue thermogenic function. EMBO J. 2017;36:1543-1558. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 133] [Cited by in RCA: 238] [Article Influence: 26.4] [Reference Citation Analysis (0)] |
| 24. | Cui L, Tan YJ, Xu SQ, Qin BF, Xiu MX, Zhang X, Shi LQ, Sun HM, Song J. Ginsenoside Rd, a natural production for attenuating fibrogenesis and inflammation in hepatic fibrosis by regulating the ERRα-mediated P2X7r pathway. Food Funct. 2023;14:5606-5619. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 18] [Reference Citation Analysis (0)] |
| 25. | Wang Y, Zheng J, Xiao X, Feng C, Li Y, Su H, Yuan D, Wang Q, Huang P, Jin L. Ginsenoside Rd Attenuates Myocardial Ischemia/Reperfusion Injury by Inhibiting Inflammation and Apoptosis through PI3K/Akt Signaling Pathway. Am J Chin Med. 2024;52:433-451. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 9] [Reference Citation Analysis (0)] |
| 26. | Fan W, Huang Y, Zheng H, Li S, Li Z, Yuan L, Cheng X, He C, Sun J. Ginsenosides for the treatment of metabolic syndrome and cardiovascular diseases: Pharmacology and mechanisms. Biomed Pharmacother. 2020;132:110915. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 31] [Cited by in RCA: 141] [Article Influence: 23.5] [Reference Citation Analysis (0)] |
| 27. | Jung E, Pyo MK, Kim J. Pectin-Lyase-Modified Ginseng Extract and Ginsenoside Rd Inhibits High Glucose-Induced ROS Production in Mesangial Cells and Prevents Renal Dysfunction in db/db Mice. Molecules. 2021;26:367. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 3] [Cited by in RCA: 15] [Article Influence: 3.0] [Reference Citation Analysis (0)] |
| 28. | Liu H, Lu X, Hu Y, Fan X. Chemical constituents of Panax ginseng and Panax notoginseng explain why they differ in therapeutic efficacy. Pharmacol Res. 2020;161:105263. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 32] [Cited by in RCA: 239] [Article Influence: 39.8] [Reference Citation Analysis (0)] |
| 29. | Tang K, Huang C, Huang Z, Wang Z, Tan N. GPR30-driven fatty acid oxidation targeted by ginsenoside Rd maintains mitochondrial redox homeostasis to restore vascular barrier in diabetic retinopathy. Cardiovasc Diabetol. 2025;24:121. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 16] [Cited by in RCA: 15] [Article Influence: 15.0] [Reference Citation Analysis (1)] |
| 30. | Wan S, Cui Z, Wu L, Zhang F, Liu T, Hu J, Tian J, Yu B, Liu F, Kou J, Li F. Ginsenoside Rd promotes omentin secretion in adipose through TBK1-AMPK to improve mitochondrial biogenesis via WNT5A/Ca(2+) pathways in heart failure. Redox Biol. 2023;60:102610. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 61] [Reference Citation Analysis (0)] |